v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-217 URS000041E210_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UACUGCAUCAGGAACUGAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-217-v1_5p (mature (guide))
  2. Bos taurus Bta-Mir-217-v1_5p (mature (guide))
  3. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-217-5p
  4. Branchiostoma floridae (Florida lancelet) bfl-miR-217
  5. Callorhinchus milii Cmi-Mir-217_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-217-v1_5p (mature (guide))
  7. Capra hircus (goat) chi-miR-217-5p
  8. Cavia porcellus (domestic guinea pig) Cpo-Mir-217-v1_5p (mature (guide))
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-217-v1_5p (mature (guide))
  10. Columba livia Cli-Mir-217-v1_5p (mature (guide))
  11. Cricetulus griseus cgr-miR-217
  12. Cyprinus carpio (common carp) ccr-miR-217
  13. Danio rerio Dre-Mir-217-v1_5p (mature (guide))
  14. Dasypus novemcinctus Dno-Mir-217-v1_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-217
  16. Gallus gallus (chicken) Gga-Mir-217-v1_5p (mature (guide))
  17. Gekko japonicus Gja-Mir-217-v1_5p (mature (guide))
  18. Homo sapiens (human) hsa-miR-217-5p
  19. Latimeria chalumnae Lch-Mir-217_5p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-217_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-miR-217
  22. Microcaecilia unicolor Mun-Mir-217-v1_5p (mature (guide))
  23. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-217_5p (mature (guide))
  24. Ornithorhynchus anatinus (platypus) oan-miR-217-5p
  25. Oryctolagus cuniculus (rabbit) Ocu-Mir-217-v1_5p (mature (guide))
  26. Pan troglodytes (chimpanzee) ptr-miR-217
  27. Petromyzon marinus pma-miR-217a
  28. Python bivittatus Pbv-Mir-217-v1_5p (mature (guide))
  29. Sarcophilus harrisii Sha-Mir-217-v1_5p (mature (guide))
  30. Scyliorhinus torazame Sto-Mir-217-v1_5p (mature (guide))
  31. Sphenodon punctatus (tuatara) Spt-Mir-217_5p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-217-v1_5p (mature (guide))
  33. Xenopus laevis (African clawed frog) Xla-Mir-217-P3-v1_5p (mature (guide))
  34. Xenopus tropicalis Xtr-Mir-217-v1_5p (mature (guide))