Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cyprinus carpio (common carp) ccr-miR-217 URS000041E210_7962

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUGCAUCAGGAACUGAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-217-v1_5p (mature (guide))
  2. Bos taurus Bta-Mir-217-v1_5p (mature (guide))
  3. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-217-5p
  4. Branchiostoma floridae (Florida lancelet) bfl-miR-217
  5. Callorhinchus milii Cmi-Mir-217_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-217-v1_5p (mature (guide))
  7. Capra hircus (goat) chi-miR-217-5p
  8. Cavia porcellus (domestic guinea pig) Cpo-Mir-217-v1_5p (mature (guide))
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-217-v1_5p (mature (guide))
  10. Columba livia Cli-Mir-217-v1_5p (mature (guide))
  11. Cricetulus griseus cgr-miR-217
  12. Danio rerio Dre-Mir-217-v1_5p (mature (guide))
  13. Dasypus novemcinctus Dno-Mir-217-v1_5p (mature (guide))
  14. Equus caballus (horse) eca-miR-217
  15. Gallus gallus (chicken) Gga-Mir-217-v1_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-217-v1_5p (mature (guide))
  17. Homo sapiens (human) hsa-miR-217-5p
  18. Latimeria chalumnae Lch-Mir-217_5p (mature (guide))
  19. Lepisosteus oculatus Loc-Mir-217_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-miR-217
  21. Microcaecilia unicolor Mun-Mir-217-v1_5p (mature (guide))
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-217_5p (mature (guide))
  23. Ornithorhynchus anatinus (platypus) oan-miR-217-5p
  24. Oryctolagus cuniculus (rabbit) Ocu-Mir-217-v1_5p (mature (guide))
  25. Pan troglodytes (chimpanzee) ptr-miR-217
  26. Petromyzon marinus pma-miR-217a
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-217
  28. Python bivittatus Pbv-Mir-217-v1_5p (mature (guide))
  29. Sarcophilus harrisii Sha-Mir-217-v1_5p (mature (guide))
  30. Scyliorhinus torazame Sto-Mir-217-v1_5p (mature (guide))
  31. Sphenodon punctatus (tuatara) Spt-Mir-217_5p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-217-v1_5p (mature (guide))
  33. Xenopus laevis (African clawed frog) Xla-Mir-217-P3-v1_5p (mature (guide))
  34. Xenopus tropicalis Xtr-Mir-217-v1_5p (mature (guide))
Publications