Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) Ocu-Mir-186_5p (mature (guide)) URS000040DCFF_9986

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 18 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGAAUUCUCCUUUUGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-186
  2. Callithrix jacchus cja-miR-186
  3. Canis lupus familiaris cfa-miR-186
  4. Capra hircus (goat) chi-miR-186-5p
  5. Cervus elaphus cel-miR-186
  6. Daubentonia madagascariensis (aye-aye) dma-miR-186
  7. Equus caballus eca-miR-186
  8. Homo sapiens (human) hsa-miR-186-5p
  9. Macaca mulatta mml-miR-186-5p
  10. Monodelphis domestica Mdo-Mir-186_5p (mature (guide))
  11. Mus musculus mmu-miR-186-5p
  12. Nomascus leucogenys nle-miR-186
  13. Ornithorhynchus anatinus (platypus) oan-miR-186-5p
  14. Papio hamadryas pha-miR-186
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-186
  16. Rattus norvegicus (Norway rat) rno-miR-186-5p
  17. Sarcophilus harrisii Sha-Mir-186_5p (mature (guide))
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-186-5p