Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-186

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-186 URS000040DCFF_61853

22 nucleotides
1 database (miRBase)
Found in 17 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAAAGAAUUCUCCUUUUGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Bos taurus (cattle) bta-miR-186
Callithrix jacchus cja-miR-186
Canis lupus familiaris cfa-miR-186
Capra hircus (goat) chi-miR-186-5p
Cervus elaphus cel-miR-186
Daubentonia madagascariensis (aye-aye) dma-miR-186
Equus caballus eca-miR-186
Homo sapiens (human) hsa-miR-186-5p
Macaca mulatta mml-miR-186-5p
Monodelphis domestica Mdo-Mir-186_5p (mature (guide))
Mus musculus mmu-miR-186-5p
Ornithorhynchus anatinus (platypus) oan-miR-186-5p
Papio hamadryas pha-miR-186
Pongo pygmaeus (Bornean orangutan) ppy-miR-186
Rattus norvegicus (Norway rat) rno-miR-186-5p
Sarcophilus harrisii Sha-Mir-186_5p (mature (guide))
Tupaia chinensis (Chinese tree shrew) tch-miR-186-5p