Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-186-5p URS000040DCFF_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGAAUUCUCCUUUUGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-186
  2. Callithrix jacchus cja-miR-186
  3. Canis lupus familiaris cfa-miR-186
  4. Capra hircus (goat) chi-miR-186-5p
  5. Cervus elaphus cel-miR-186
  6. Daubentonia madagascariensis (aye-aye) dma-miR-186
  7. Equus caballus eca-miR-186
  8. Homo sapiens (human) hsa-miR-186-5p
  9. Macaca mulatta mml-miR-186-5p
  10. Monodelphis domestica Mdo-Mir-186_5p (mature (guide))
  11. Nomascus leucogenys nle-miR-186
  12. Ornithorhynchus anatinus (platypus) oan-miR-186-5p
  13. Papio hamadryas pha-miR-186
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-186
  15. Rattus norvegicus (Norway rat) rno-miR-186-5p
  16. Sarcophilus harrisii Sha-Mir-186_5p (mature (guide))
  17. Tupaia chinensis (Chinese tree shrew) tch-miR-186-5p
Publications