Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-186-5p URS000040DCFF_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, GeneCards, PSICQUIC, MalaCards, miRBase, LncBase, ENA, TarBase). Described in 66 papers. Homo sapiens (human) hsa-miR-186-5p sequence is a product of hsa-miR-186-5p, miR-186, MIR186, hsa-miR-186, miR-186-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 133K02, 14-3-3-zeta, 2'-PDE, 20D7-FC4, 3-PAP, 3635, 3PAP, 4-1BB-L, 4-1BBL, 4.1-G.

Interactions 6

According to PSICQUIC, Homo sapiens (human) hsa-miR-186-5p interacts with:

Interaction id Participant Synonyms
URS000040DCFF_9606-0 P08183 P08183
URS000040DCFF_9606-3 P08183 P08183
URS000040DCFF_9606-1 P10636 P10636
URS000040DCFF_9606-4 P10636 P10636
URS000040DCFF_9606-2 Q92542 Q92542
URS000040DCFF_9606-5 Q92542 Q92542

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAAAGAAUUCUCCUUUUGGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 32 other species

    1. Bos taurus (cattle) bta-miR-186
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-186
    3. Canis lupus familiaris (dog) cfa-miR-186
    4. Capra hircus chi-miR-186-5p
    5. Cavia porcellus Cpo-Mir-186_5p (mature (guide))
    6. Cervus elaphus (red deer) cel-miR-186
    7. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-186_5p (mature (guide))
    8. Daubentonia madagascariensis dma-miR-186
    9. Echinops telfairi Ete-Mir-186_5p (mature (guide))
    10. Equus caballus eca-miR-186
    11. Macaca mulatta mml-miR-186-5p
    12. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-186_5p (mature (guide))
    13. Mus musculus mmu-miR-186-5p
    14. Nomascus leucogenys nle-miR-186
    15. Ornithorhynchus anatinus oan-miR-186-5p
    16. Oryctolagus cuniculus Ocu-Mir-186_5p (mature (guide))
    17. Papio hamadryas pha-miR-186
    18. Pongo pygmaeus ppy-miR-186
    19. Rattus norvegicus rno-miR-186-5p
    20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-186_5p (mature (guide))
    21. Tupaia chinensis (Chinese tree shrew) tch-miR-186-5p