Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-100-5p URS000040D674_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-100: Rno-mir-100 is a microRNA that has been studied in various contexts [PMC4271342]. In one study, a mutant 3'-UTR of IGF1R with a modified binding site to rno-mir-100 was created using a Site-Directed Mutagenesis Kit [PMC4271342]. Oligonucleotides of rno-mir-100 inhibitor, rno-mir-100 mimics, and non-specific control were purchased from Ribo-Bio [PMC4271342]. Comparing significantly deregulated miRNAs in different groups, it was found that rno-mir-100 showed similar expression changes in both groups at the same postoperative time point [PMC4198680]. Out of the miRNAs found to be similarly regulated, only rno-mir-100, along with rno-miR-133a, rno-miR-133b, and rno-miR-466c were consistently detected in all plasma samples [PMC4198680]. Rno-mir-100 was downregulated following certain treatments such as surgery and anesthesia [PMC4198680]. However, it was significantly upregulated following isoflurane anesthesia compared to untreated animals [PMC4198680]. TaqMan mature miR assays were used to quantify the expression levels of various miRNAs including rno-mir-100 [PMC5838212]. In another study, it was found that at 24 hours and 48 hours after treatment with certain drugs or conditions, several miRNAs including rno-mir-100 showed dysregulation [PMC5856749].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAACUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 85 other species

  1. Aedes aegypti aae-miR-100
  2. Alligator mississippiensis ami-miR-100-5p
  3. Anolis carolinensis aca-miR-100
  4. Anopheles gambiae (African malaria mosquito) aga-miR-100
  5. Apis mellifera ame-miR-100-5p
  6. Ateles geoffroyi (black-handed spider monkey) age-miR-100
  7. Blattella germanica Bge-Mir-10-P2_5p (mature (guide))
  8. Bombyx mori bmo-miR-100
  9. Bos taurus bta-miR-100
  10. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-100-5p
  11. Brugia malayi (agent of lymphatic filariasis) bma-miR-100b
  12. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-100
  13. Capra hircus (goat) miR-100
  14. Cavia porcellus (domestic guinea pig) cpo-miR-100-5p
  15. Centruroides sculpturatus (bark scorpion) Csc-Mir-10-P2r1_5p (mature (guide))
  16. Chrysemys picta bellii Cpi-Mir-10-P2d_5p (mature (guide))
  17. Columba livia cli-miR-100-5p
  18. Crassostrea gigas Cgi-Mir-10-P2_5p (mature (guide))
  19. Culex quinquefasciatus (southern house mosquito) cqu-miR-100-5p
  20. Danio rerio dre-miR-100-5p
  21. Daphnia magna Dma-Mir-10-P2_5p (mature (guide))
  22. Daphnia pulex Dpu-Mir-10-P2_5p (mature (guide))
  23. Dasypus novemcinctus (nine-banded armadillo) dno-miR-100-5p
  24. Echinops telfairi Ete-Mir-10-P2d_5p (mature (guide))
  25. Eptatretus burgeri (inshore hagfish) Ebu-Mir-10-P2f_5p (mature (guide))
  26. Equus caballus (horse) eca-miR-100
  27. Gadus morhua (Atlantic cod) gmo-miR-100a-5p
  28. Gallus gallus gga-miR-100-5p
  29. Gekko japonicus Gja-Mir-10-P2d_5p (mature (guide))
  30. Gorilla gorilla gorilla ggo-miR-100 (MIR100)
  31. Gorilla gorilla (western gorilla) ggo-miR-100
  32. Haplochromis burtoni abu-miR-100
  33. Homo sapiens (human) hsa-miR-100-5p
  34. Ictalurus punctatus ipu-miR-100
  35. Ixodes ricinus (castor bean tick) iri-miR-100-5p
  36. Ixodes scapularis (black-legged tick) Isc-Mir-10-P2_5p (mature (guide))
  37. Lagothrix lagotricha (brown woolly monkey) lla-miR-100
  38. Latimeria chalumnae (coelacanth) Lch-Mir-10-P2d_5p (mature (guide))
  39. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P2d_5p (mature (guide))
  40. Lingula anatina Lan-Mir-10-P2_5p (mature (guide))
  41. Lottia gigantea lgi-miR-100
  42. Macaca mulatta mml-miR-100-5p
  43. Manduca sexta mse-miR-100
  44. Maylandia zebra (zebra mbuna) mze-miR-100
  45. Microcaecilia unicolor Mun-Mir-10-P2d_5p (mature (guide))
  46. Microcebus murinus mmr-miR-100
  47. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P2d_5p (mature (guide))
  48. Monopterus albus Mal-Mir-10-P2d1_5p (mature (guide))
  49. Mus musculus (house mouse) mmu-miR-100-5p
  50. Nasonia vitripennis (jewel wasp) nvi-miR-100
  51. Neolamprologus brichardi (lyretail cichlid) nbr-miR-100
  52. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-100
  53. Oreochromis niloticus oni-miR-100
  54. Ornithorhynchus anatinus oan-miR-100-5p
  55. Oryctolagus cuniculus (rabbit) ocu-miR-100-5p
  56. Otolemur garnettii oga-miR-100
  57. Ovis aries miscellaneous RNA
  58. Pan paniscus ppa-miR-100
  59. Pan troglodytes ptr-miR-100
  60. Papio hamadryas (hamadryas baboon) pha-miR-100
  61. Parasteatoda tepidariorum (common house spider) pte-miR-100b-5p
  62. Patiria miniata (sea bat) Pmi-Mir-10-P2_5p (mature (guide))
  63. Penaeus japonicus miR-100
  64. Petromyzon marinus (sea lamprey) pma-miR-100a-5p
  65. Pongo pygmaeus ppy-miR-100
  66. Pteropus alecto pal-miR-100-5p
  67. Ptychodera flava Pfl-Mir-10-P2_5p (mature (guide))
  68. Pundamilia nyererei pny-miR-100
  69. Python bivittatus (Burmese python) pbv-miR-100-5p
  70. Saccoglossus kowalevskii sko-miR-100
  71. Saguinus labiatus (red-chested mustached tamarin) sla-miR-100
  72. Salmo salar ssa-miR-100a-5p
  73. Sarcophilus harrisii Sha-Mir-10-P2d_5p (mature (guide))
  74. Scyliorhinus torazame Sto-Mir-10-P2d_5p (mature (guide))
  75. Sphenodon punctatus (tuatara) Spt-Mir-10-P2d_5p (mature (guide))
  76. Sus scrofa ssc-miR-100
  77. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P2d_5p (mature (guide))
  78. Takifugu rubripes (torafugu) fru-miR-100
  79. Tetraodon nigroviridis tni-miR-100
  80. Tor tambroides (Thai mahseer) miR-100-5p
  81. Tribolium castaneum (red flour beetle) Tca-Mir-10-P2_5p (mature (guide))
  82. Triops cancriformis tcf-miR-100
  83. Tupaia chinensis tch-miR-100-5p
  84. Xenopus laevis xla-miR-100-5p
  85. Xenopus tropicalis (tropical clawed frog) xtr-miR-100
Publications