Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-100 URS000040D674_7159

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aae-mir-100: Aae-mir-100 is an endogenous miRNA that has been used as an endogenous control in qPCR experiments to obtain expression profiles of anti-DENV miRNAs [PMC8668939]. It has been found to be highly expressed in CHIKV-infected Ae.albopictus saliva, along with aae-mir-125, aae-mir-263a, aae-mir-8, and aae-mir-184 [PMC4303268]. These same miRNAs were also highly expressed in Ae.aegypti saliva [PMC4303268]. In both Ae.albopictus and Ae.aegypti saliva, aae-mir-125 and aae-mir-100 were upregulated in CHIKV-infected samples [PMC4303268]. A target prediction analysis revealed that aae-mir-100 targets CDC42 and sumo-ligase [PMC7690852]. Additionally, the expression of aae-mir-100 was found to be significantly upregulated along with other miRNAs such as aae-miR-283 and aae-miR-305-3p [PMC7690852]. These miRNAs were also found to affect NK cell-mediated cytotoxicity and protein processing in ER pathways [PMC7690852]. In summary, the endogenous miRNA aae-mir-100 is used as an endogenous control in qPCR experiments to study anti-DENV miRNAs. It is highly expressed in CHIKV-infected Ae.albopictus saliva and is upregulated in both Ae.albopictus and Ae.aegypti saliva during CHIKV infection. A target prediction analysis revealed that it targets CDC42 and sumo-ligase. Additionally, the expression of aae-mir-100 was found to be significantly upregulated along with other miRNAs, and these miRNAs were found to affect NK cell-mediated cytotoxicity and protein processing in ER pathways. [PMC8668939] [PMC4303268] [PMC7690852]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAACUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 85 other species

  1. Alligator mississippiensis ami-miR-100-5p
  2. Anolis carolinensis aca-miR-100
  3. Anopheles gambiae (African malaria mosquito) aga-miR-100
  4. Apis mellifera ame-miR-100-5p
  5. Ateles geoffroyi (black-handed spider monkey) age-miR-100
  6. Blattella germanica Bge-Mir-10-P2_5p (mature (guide))
  7. Bombyx mori bmo-miR-100
  8. Bos taurus bta-miR-100
  9. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-100-5p
  10. Brugia malayi (agent of lymphatic filariasis) bma-miR-100b
  11. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-100
  12. Capra hircus (goat) miR-100
  13. Cavia porcellus (domestic guinea pig) cpo-miR-100-5p
  14. Centruroides sculpturatus (bark scorpion) Csc-Mir-10-P2r1_5p (mature (guide))
  15. Chrysemys picta bellii Cpi-Mir-10-P2d_5p (mature (guide))
  16. Columba livia cli-miR-100-5p
  17. Crassostrea gigas Cgi-Mir-10-P2_5p (mature (guide))
  18. Culex quinquefasciatus (southern house mosquito) cqu-miR-100-5p
  19. Danio rerio dre-miR-100-5p
  20. Daphnia magna Dma-Mir-10-P2_5p (mature (guide))
  21. Daphnia pulex Dpu-Mir-10-P2_5p (mature (guide))
  22. Dasypus novemcinctus (nine-banded armadillo) dno-miR-100-5p
  23. Echinops telfairi Ete-Mir-10-P2d_5p (mature (guide))
  24. Eptatretus burgeri (inshore hagfish) Ebu-Mir-10-P2f_5p (mature (guide))
  25. Equus caballus (horse) eca-miR-100
  26. Gadus morhua (Atlantic cod) gmo-miR-100a-5p
  27. Gallus gallus gga-miR-100-5p
  28. Gekko japonicus Gja-Mir-10-P2d_5p (mature (guide))
  29. Gorilla gorilla gorilla ggo-miR-100 (MIR100)
  30. Gorilla gorilla (western gorilla) ggo-miR-100
  31. Haplochromis burtoni abu-miR-100
  32. Homo sapiens (human) hsa-miR-100-5p
  33. Ictalurus punctatus ipu-miR-100
  34. Ixodes ricinus (castor bean tick) iri-miR-100-5p
  35. Ixodes scapularis (black-legged tick) Isc-Mir-10-P2_5p (mature (guide))
  36. Lagothrix lagotricha (brown woolly monkey) lla-miR-100
  37. Latimeria chalumnae (coelacanth) Lch-Mir-10-P2d_5p (mature (guide))
  38. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P2d_5p (mature (guide))
  39. Lingula anatina Lan-Mir-10-P2_5p (mature (guide))
  40. Lottia gigantea lgi-miR-100
  41. Macaca mulatta mml-miR-100-5p
  42. Manduca sexta mse-miR-100
  43. Maylandia zebra (zebra mbuna) mze-miR-100
  44. Microcaecilia unicolor Mun-Mir-10-P2d_5p (mature (guide))
  45. Microcebus murinus mmr-miR-100
  46. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P2d_5p (mature (guide))
  47. Monopterus albus Mal-Mir-10-P2d1_5p (mature (guide))
  48. Mus musculus (house mouse) mmu-miR-100-5p
  49. Nasonia vitripennis (jewel wasp) nvi-miR-100
  50. Neolamprologus brichardi (lyretail cichlid) nbr-miR-100
  51. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-100
  52. Oreochromis niloticus oni-miR-100
  53. Ornithorhynchus anatinus oan-miR-100-5p
  54. Oryctolagus cuniculus (rabbit) ocu-miR-100-5p
  55. Otolemur garnettii oga-miR-100
  56. Ovis aries miscellaneous RNA
  57. Pan paniscus ppa-miR-100
  58. Pan troglodytes ptr-miR-100
  59. Papio hamadryas (hamadryas baboon) pha-miR-100
  60. Parasteatoda tepidariorum (common house spider) pte-miR-100b-5p
  61. Patiria miniata (sea bat) Pmi-Mir-10-P2_5p (mature (guide))
  62. Penaeus japonicus miR-100
  63. Petromyzon marinus (sea lamprey) pma-miR-100a-5p
  64. Pongo pygmaeus ppy-miR-100
  65. Pteropus alecto pal-miR-100-5p
  66. Ptychodera flava Pfl-Mir-10-P2_5p (mature (guide))
  67. Pundamilia nyererei pny-miR-100
  68. Python bivittatus (Burmese python) pbv-miR-100-5p
  69. Rattus norvegicus rno-miR-100-5p
  70. Saccoglossus kowalevskii sko-miR-100
  71. Saguinus labiatus (red-chested mustached tamarin) sla-miR-100
  72. Salmo salar ssa-miR-100a-5p
  73. Sarcophilus harrisii Sha-Mir-10-P2d_5p (mature (guide))
  74. Scyliorhinus torazame Sto-Mir-10-P2d_5p (mature (guide))
  75. Sphenodon punctatus (tuatara) Spt-Mir-10-P2d_5p (mature (guide))
  76. Sus scrofa ssc-miR-100
  77. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P2d_5p (mature (guide))
  78. Takifugu rubripes (torafugu) fru-miR-100
  79. Tetraodon nigroviridis tni-miR-100
  80. Tor tambroides (Thai mahseer) miR-100-5p
  81. Tribolium castaneum (red flour beetle) Tca-Mir-10-P2_5p (mature (guide))
  82. Triops cancriformis tcf-miR-100
  83. Tupaia chinensis tch-miR-100-5p
  84. Xenopus laevis xla-miR-100-5p
  85. Xenopus tropicalis (tropical clawed frog) xtr-miR-100
Publications