Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-100-5p URS000040D674_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, LncBase, GeneCards, miRBase, TarBase, MalaCards, ENA, IntAct, RefSeq). Homo sapiens (human) hsa-miR-100-5p sequence is a product of hsa-miR-100-5p, hsa-miR-100, miR-100, 100, MIR100, miR-100-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 16A, 2'-PDE, 2C18, 3635, 3OST2, 4F5, 76P, 90K, A-myb.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-miR-100-5p interacts with:

Interaction id Participant Synonyms
EBI-26451296 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AACCCGUAGAUCCGAACUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 84 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-100
    2. Alligator mississippiensis (American alligator) ami-miR-100-5p
    3. Anolis carolinensis aca-miR-100
    4. Anopheles gambiae aga-miR-100
    5. Apis mellifera (honey bee) ame-miR-100-5p
    6. Ateles geoffroyi (black-handed spider monkey) age-miR-100
    7. Blattella germanica (German cockroach) Bge-Mir-10-P2_5p (mature (guide))
    8. Bombyx mori bmo-miR-100
    9. Bos taurus bta-miR-100
    10. Branchiostoma belcheri bbe-miR-100-5p
    11. Brugia malayi bma-miR-100b
    12. Callithrix jacchus cja-miR-100
    13. Capra hircus (goat) miR-100
    14. Cavia porcellus cpo-miR-100-5p
    15. Centruroides sculpturatus Csc-Mir-10-P2r1_5p (mature (guide))
    16. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P2d_5p (mature (guide))
    17. Columba livia (rock pigeon) cli-miR-100-5p
    18. Crassostrea gigas (Pacific oyster) Cgi-Mir-10-P2_5p (mature (guide))
    19. Culex quinquefasciatus (southern house mosquito) cqu-miR-100-5p
    20. Danio rerio (zebrafish) dre-miR-100-5p
    21. Daphnia magna Dma-Mir-10-P2_5p (mature (guide))
    22. Daphnia pulex (common water flea) Dpu-Mir-10-P2_5p (mature (guide))
    23. Dasypus novemcinctus dno-miR-100-5p
    24. Echinops telfairi Ete-Mir-10-P2d_5p (mature (guide))
    25. Eptatretus burgeri Ebu-Mir-10-P2f_5p (mature (guide))
    26. Equus caballus eca-miR-100
    27. Gadus morhua gmo-miR-100a-5p
    28. Gallus gallus (chicken) gga-miR-100-5p
    29. Gekko japonicus Gja-Mir-10-P2d_5p (mature (guide))
    30. Gorilla gorilla (western gorilla) ggo-miR-100
    31. Haplochromis burtoni abu-miR-100
    32. Ictalurus punctatus (channel catfish) ipu-miR-100
    33. Ixodes ricinus iri-miR-100-5p
    34. Ixodes scapularis (black-legged tick) Isc-Mir-10-P2_5p (mature (guide))
    35. Lagothrix lagotricha (brown woolly monkey) lla-miR-100
    36. Latimeria chalumnae Lch-Mir-10-P2d_5p (mature (guide))
    37. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P2d_5p (mature (guide))
    38. Lingula anatina Lan-Mir-10-P2_5p (mature (guide))
    39. Lottia gigantea lgi-miR-100
    40. Macaca mulatta (Rhesus monkey) mml-miR-100-5p
    41. Manduca sexta (tobacco hornworm) mse-miR-100
    42. Maylandia zebra (zebra mbuna) mze-miR-100
    43. Microcaecilia unicolor Mun-Mir-10-P2d_5p (mature (guide))
    44. Microcebus murinus mmr-miR-100
    45. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P2d_5p (mature (guide))
    46. Monopterus albus Mal-Mir-10-P2d1_5p (mature (guide))
    47. Mus musculus mmu-miR-100-5p
    48. Nasonia vitripennis nvi-miR-100
    49. Neolamprologus brichardi nbr-miR-100
    50. Nomascus leucogenys nle-miR-100
    51. Oreochromis niloticus oni-miR-100
    52. Ornithorhynchus anatinus (platypus) oan-miR-100-5p
    53. Oryctolagus cuniculus ocu-miR-100-5p
    54. Otolemur garnettii oga-miR-100
    55. Ovis aries (sheep) miscellaneous RNA
    56. Pan paniscus (pygmy chimpanzee) ppa-miR-100
    57. Pan troglodytes ptr-miR-100
    58. Papio hamadryas (hamadryas baboon) pha-miR-100
    59. Parasteatoda tepidariorum (common house spider) pte-miR-100b-5p
    60. Patiria miniata Pmi-Mir-10-P2_5p (mature (guide))
    61. Penaeus japonicus miR-100
    62. Petromyzon marinus (sea lamprey) pma-miR-100a-5p
    63. Pongo pygmaeus ppy-miR-100
    64. Pteropus alecto pal-miR-100-5p
    65. Ptychodera flava Pfl-Mir-10-P2_5p (mature (guide))
    66. Pundamilia nyererei pny-miR-100
    67. Python bivittatus (Burmese python) pbv-miR-100-5p
    68. Rattus norvegicus (Norway rat) rno-miR-100-5p
    69. Saccoglossus kowalevskii sko-miR-100
    70. Saguinus labiatus (red-chested mustached tamarin) sla-miR-100
    71. Salmo salar ssa-miR-100a-5p
    72. Sarcophilus harrisii Sha-Mir-10-P2d_5p (mature (guide))
    73. Scyliorhinus torazame Sto-Mir-10-P2d_5p (mature (guide))
    74. Sphenodon punctatus (tuatara) Spt-Mir-10-P2d_5p (mature (guide))
    75. Sus scrofa (pig) ssc-miR-100
    76. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P2d_5p (mature (guide))
    77. Takifugu rubripes (torafugu) fru-miR-100
    78. Tetraodon nigroviridis tni-miR-100
    79. Tor tambroides (Thai mahseer) miR-100-5p
    80. Tribolium castaneum Tca-Mir-10-P2_5p (mature (guide))
    81. Triops cancriformis tcf-miR-100
    82. Tupaia chinensis tch-miR-100-5p
    83. Xenopus laevis xla-miR-100-5p
    84. Xenopus tropicalis xtr-miR-100
    Publications New