Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR399c-3p URS00003CFBD5_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR399c-3p: Ath-mir399c-3p is a type of microRNA that is involved in phosphate starvation regulation. Seaweed extract treatment significantly reduces the expression of ath-mir399c-3p, along with other related genes (ath-miR399a, ath-miR399b, and ath-miR399c-5p) [PMC8000310]. The expression of ath-mir399c-3p is suppressed or not strongly influenced by ANE (aneurysm extract) and ANE+NaCl treatments, while NaCl treatment clearly induces the expression of this microRNA [PMC6205635]. The application of ANE in the presence of NaCl leads to a lower expression of ath-mir399c-3p compared to plants treated with NaCl alone [PMC6205635]. ANE and ANE+NaCl treatments reduce the expression of ath-mir399c-3p at 6 h and 12 h, while NaCl alone enhances its expression at both time points [PMC6205635]. The induction of AtWAK2 gene by ANE+NaCl treatment cannot be attributed to the expression changes in ath-mir399c-3p and 5p [PMC6205635]. Similar patterns are observed for other microRNAs (ath-miR399a, ath-miR399b, and miR827) with moderate effects from ANE and pronounced activation by salinity (NaCl alone) at one or both time points [PMC6205635]. Ath-mir399c-3p is significantly down-regulated along with other miRNAs in response to certain conditions related to seed germination [PMC8151434]. These miRNAs are found to be related to plant hormones based on KEGG and GO analysis [PMC8151434].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCAAAGGAGAGUUGCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Ananas comosus microRNA 399b
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR399c-3p
  3. Asparagus officinalis (garden asparagus) aof-miR399a
  4. Citrus sinensis csi-miR399d-3p
  5. Corchorus olitorius aly-miR399a-
  6. Fragaria vesca subsp. vesca fve-miR399a
  7. Glycine max (soybean) gma-miR399c
  8. Helianthus annuus (common sunflower) ath-miR399b
  9. Malus domestica (apple) mdm-miR399j
  10. Manihot esculenta (cassava) mes-miR399f
  11. Medicago truncatula (barrel medic) mtr-miR399p
  12. Oryza sativa (Asian cultivated rice) osa-miR399d
  13. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR399d
  14. Phaseolus vulgaris (string bean) pvu-miR399a
  15. Picea abies (Norway spruce) pab-miR399d
  16. Ricinus communis rco-miR399a
  17. Sorghum bicolor (sorghum) sbi-miR399i
  18. Theobroma cacao (cacao) tcc-miR399i
  19. Vigna unguiculata vun-miR399a
  20. Vitis vinifera vvi-miR399c
  21. Zea mays (maize) zma-miR399e-3p
Publications