Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Picea abies (Norway spruce) pab-miR399d URS00003CFBD5_3329

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCAAAGGAGAGUUGCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Ananas comosus microRNA 399b
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR399c-3p
  3. Arabidopsis thaliana (thale cress) ath-miR399c-3p
  4. Asparagus officinalis (garden asparagus) aof-miR399a
  5. Citrus sinensis csi-miR399d-3p
  6. Corchorus olitorius aly-miR399a-
  7. Fragaria vesca subsp. vesca fve-miR399a
  8. Glycine max (soybean) gma-miR399c
  9. Helianthus annuus (common sunflower) ath-miR399b
  10. Malus domestica (apple) mdm-miR399j
  11. Manihot esculenta (cassava) mes-miR399f
  12. Medicago truncatula (barrel medic) mtr-miR399p
  13. Oryza sativa (Asian cultivated rice) osa-miR399d
  14. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR399d
  15. Phaseolus vulgaris (string bean) pvu-miR399a
  16. Ricinus communis rco-miR399a
  17. Sorghum bicolor (sorghum) sbi-miR399i
  18. Theobroma cacao (cacao) tcc-miR399i
  19. Vigna unguiculata vun-miR399a
  20. Vitis vinifera vvi-miR399c
  21. Zea mays (maize) zma-miR399e-3p