Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-8-5p URS00003C2D16_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-8: bmo-mir-8 is a literature-based and database-collected microRNA (miRNA) that has been studied in the context of Bombyx mori (silkworm) and its viral infection. It has been found that miRNAs collected from miRBase, including bmo-mir-8, showed stronger signals compared to other miRNAs [PMC4045974]. Bmo-mir-8 is a host miRNA that targets the mRNA of the viral gene ie-1, a master regulator of the viral infection cycle [PMC5469917]. Blocking bmo-mir-8 resulted in a significant increase in the virus load in infected silkworm larvae [PMC8373394]. The suppression of bmo-mir-8 led to a 3-fold increase in ie-1 transcript level and an 8-fold increase in BmNPV accumulation in fat body tissues of infected larvae [PMC8137832]. Bmo-mir-8 is one of the highly abundant conserved miRNAs found in B. mori [PMC3699532]. It has been identified as an anti-viral miRNA that is suppressed by BmNPV following infection or transfection of abmnpv-miR-1 into host cells [PMC5091789]. Bmo-mir-8, along with other miRNAs like bmo-miR-9a and bmo-miR263a, showed slight elevation after diapause-broken stage (DBS) and maintained relatively constant levels thereafter [PMC2500172]. It is strongly expressed throughout all developmental stages (larva, pupa, and moth) along with other miRNAs like bmo-miR1a and bmolet7a [PMC2435238]. The relative abundance of bmo-mir1a, bmo-mir-8, and bmo-mir-133 in BmN cells has been analyzed using quantitative RT-PCR [PMC4222307]. Bmo-mir-8 has been found to target the immediate-early gene, which can be controlled by bmnpv-miR-1 and Ran dsRNA, resulting in increased virus infection levels in B. mori larvae [PMC4222307].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCUUACCGGGCAGCAUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Aedes aegypti aae-miR-8-5p
  2. Cochliomyia hominivorax mature cho-miR-8-5p
  3. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-8-5p
  4. Culex quinquefasciatus (southern house mosquito) cqu-miR-8-5p
  5. Dinoponera quadriceps dqu-miR-8-5p
  6. Drosophila melanogaster dme-miR-8-5p
  7. Drosophila virilis dvi-miR-8-5p
  8. Locusta migratoria lmi-miR-8-5p
  9. Tribolium castaneum tca-miR-8-5p
  10. Triops cancriformis tcf-miR-8-5p
Publications