Cochliomyia macellaria (secondary screw-worm) mature cma-miR-8-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia macellaria (secondary screw-worm) mature cma-miR-8-5p URS00003C2D16_66361

22 nucleotides
1 database (ENA)
Found in 10 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAUCUUACCGGGCAGCAUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Aedes aegypti aae-miR-8-5p
Bombyx mori bmo-miR-8-5p
Cochliomyia hominivorax mature cho-miR-8-5p
Culex quinquefasciatus (southern house mosquito) cqu-miR-8-5p
Dinoponera quadriceps dqu-miR-8-5p
Drosophila melanogaster dme-miR-8-5p
Drosophila virilis dvi-miR-8-5p
Locusta migratoria lmi-miR-8-5p
Tribolium castaneum tca-miR-8-5p
Triops cancriformis tcf-miR-8-5p