v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR396a-5p URS000039FDDC_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR396a-5p: Novel_6, novel_8, osa-miR167d-5p, mtr-miR319a-3p, ptc-miR396f, novel_9, ath-mir396a-5p, gma-miR396h, and zma-miR396g-3p were the most expressed DEMs in each sample [PMC9962977]. By using reverse-cDNA fragments as probes, we validated our bioinformatics prediction by northern blotting assay [PMC9203150]. The expression of ath-mir396a-5p was analyzed using qPCR with TaqMan miRNA assays [PMC8991712]. In the presence of ANE+NaCl, the expression of ath-mir396a-5p was higher after 12 hours compared to NaCl alone [PMC6205635]. Ath-mir396a-5p down-regulated the expression of AtGRF7, which is involved in salinity tolerance in Arabidopsis [PMC6205635]. In R lines, ath-mir396a-5p was downregulated at 2 dpi/6 dpi, leading to upregulation of its target gene EL10Ac5g11116 (chaperone protein) [PMC8786109]. Additionally, ath-mir396a-5p was found to co-regulate NFYA2 with ath-miR169a-5p and ath-miR169d [PMC7769420].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCCACAGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Acacia auriculiformis aau-miR396
  2. Acacia mangium amg-miR396
  3. Aegilops tauschii ata-miR396e-5p
  4. Ananas comosus (pineapple) vvi-miR396d
  5. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396a
  6. Arabidopsis lyrata (lyrate rockcress) aly-miR396a-5p
  7. Asparagus officinalis aof-miR396b
  8. Brachypodium distachyon bdi-miR396d-5p
  9. Bruguiera cylindrica bcy-miR396a
  10. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396a
  11. Camelina sativa (false flax) cas-miR396a
  12. Carica papaya cpa-miR396
  13. Citrus sinensis (sweet orange) csi-miR396b-5p
  14. Cucumis melo (muskmelon) cme-miR396b
  15. Digitalis purpurea dpr-miR396
  16. Eugenia uniflora (Brazil-cherry) eun-miR396b-5p
  17. Fragaria vesca subsp. vesca fve-miR396c-5p
  18. Glycine max gma-miR396i-5p
  19. Gossypium hirsutum (cotton) ghr-miR396b
  20. Helianthus annuus ath-miR396a-5p
  21. Hevea brasiliensis hbr-miR396b
  22. Linum usitatissimum (flax) lus-miR396a
  23. Lotus japonicus lja-miR396
  24. Malus domestica (apple) mdm-miR396b
  25. Manihot esculenta mes-miR396b
  26. Medicago truncatula mtr-miR396b-5p
  27. Nicotiana attenuata microRNA mir-396-like
  28. Nicotiana tabacum (common tobacco) nta-miR396a
  29. Oryza sativa (Asian cultivated rice) osa-miR396b-5p
  30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
  31. Populus tomentosa Pto-miR396b
  32. Populus trichocarpa (black cottonwood) ptc-miR396b
  33. Rosa chinensis ath-miR396a-5p
  34. Saccharum officinarum (sugarcane) sof-miR396
  35. Saccharum sp. ssp-miR396
  36. Salvia sclarea (clary) ssl-miR396
  37. Solanum lycopersicum sly-miR396a-5p
  38. Sorghum bicolor sbi-miR396a
  39. Theobroma cacao (cacao) tcc-miR396a
  40. Vitis vinifera vvi-miR396c
  41. Zea mays (maize) zma-miR396a-5p
 Publications