Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2) secondary structure diagram

Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2) URS000039EE20_7220

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Aedes albopictus tRNA tRNA-Ser
  2. Anopheles arabiensis (Southern African malaria mosquito) tRNA
  3. Anopheles atroparvus tRNA
  4. Anopheles coluzzii (Mosquito) tRNA tRNA-Ser
  5. Anopheles culicifacies (Mosquito) tRNA tRNA-Ser
  6. Anopheles dirus tRNA tRNA-Ser
  7. Anopheles epiroticus tRNA tRNA-Ser
  8. Anopheles farauti tRNA tRNA-Ser
  9. Anopheles funestus tRNA-Ser for anticodon AGA
  10. Anopheles gambiae tRNA tRNA-Ser
  11. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1, tRNA-Ser-AGA-2-2)
  12. Anopheles melas (Mosquito) tRNA tRNA-Ser
  13. Anopheles merus (Mosquito) tRNA tRNA-Ser
  14. Anopheles minimus tRNA
  15. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Ser
  16. Anopheles sinensis (Mosquito) tRNA tRNA-Ser
  17. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Ser
  18. Aromia moschata tRNA-Ser
  19. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  20. Drosophila busckii tRNA
  21. Drosophila grimshawi tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  22. Drosophila gunungcola tRNA-OTHER
  23. Drosophila melanogaster transfer RNA:Serine-AGA 3-1 (Dmel_CR32612, Dmel_CR32618)
  24. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  25. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  26. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  27. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  28. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  29. Glossina austeni tRNA tRNA-Ser
  30. Glossina fuscipes fuscipes tRNA
  31. Glossina morsitans morsitans tRNA tRNA-Ser
  32. Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser
  33. Glossina palpalis gambiensis tRNA tRNA-Ser
2D structure Publications