v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Aromia moschata tRNA-Ser secondary structure diagram

Aromia moschata tRNA-Ser URS000039EE20_1265417

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Ser
  2. Anopheles arabiensis tRNA
  3. Anopheles atroparvus tRNA
  4. Anopheles coluzzii tRNA tRNA-Ser
  5. Anopheles culicifacies tRNA tRNA-Ser
  6. Anopheles dirus (Mosquito) tRNA tRNA-Ser
  7. Anopheles epiroticus (Mosquito) tRNA tRNA-Ser
  8. Anopheles farauti tRNA tRNA-Ser
  9. Anopheles funestus tRNA-Ser for anticodon AGA
  10. Anopheles gambiae tRNA tRNA-Ser
  11. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1, tRNA-Ser-AGA-2-2)
  12. Anopheles melas tRNA tRNA-Ser
  13. Anopheles merus (Mosquito) tRNA tRNA-Ser
  14. Anopheles minimus tRNA
  15. Anopheles quadriannulatus tRNA tRNA-Ser
  16. Anopheles sinensis tRNA tRNA-Ser
  17. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Ser
  18. Drosophila albomicans (Fruit fly) transfer RNA serine (anticodon AGA)
  19. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  20. Drosophila arizonae (Fruit fly) tRNA-Ser
  21. Drosophila biarmipes (Fruit fly) transfer RNA serine (anticodon AGA)
  22. Drosophila busckii (Fruit fly) tRNA-Ser
  23. Drosophila elegans (Pomace flies) tRNA-Ser
  24. Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  25. Drosophila eugracilis (Fruit fly) tRNA-Ser
  26. Drosophila grimshawi tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  27. Drosophila gunungcola (Fruit fly) transfer RNA serine (anticodon AGA)
  28. Drosophila hydei (Fruit fly) tRNA-Ser
  29. Drosophila innubila (Fruit fly) tRNA-Ser
  30. Drosophila kikkawai (Pomace flies) transfer RNA serine (anticodon AGA)
  31. Drosophila mauritiana (Fruit fly) tRNA-Ser
  32. Drosophila melanogaster transfer RNA:Serine-AGA 3-1 (Dmel_CR32612, Dmel_CR32618)
  33. Drosophila miranda (Fruit fly) tRNA-Ser
  34. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  35. Drosophila montana (Pomace flies) transfer RNA serine (anticodon AGA)
  36. Drosophila nasuta (Pomace flies) transfer RNA serine (anticodon AGA)
  37. Drosophila navojoa (Fruit fly) tRNA-Ser
  38. Drosophila novamexicana (Pomace flies) tRNA-Ser
  39. Drosophila rhopaloa (Fruit fly) tRNA-Ser
  40. Drosophila santomea (Fruit fly) tRNA-Ser
  41. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  42. Drosophila serrata (Pomace flies) tRNA-Ser
  43. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  44. Drosophila subpulchrella (Fruit fly) tRNA-Ser
  45. Drosophila sulfurigaster albostrigata (Flies) transfer RNA serine (anticodon AGA)
  46. Drosophila suzukii (Pomace flies) transfer RNA serine (anticodon AGA)
  47. Drosophila takahashii (Pomace flies) transfer RNA serine (anticodon AGA)
  48. Drosophila teissieri (Fruit fly) tRNA-Ser
  49. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  50. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  51. Glossina austeni tRNA tRNA-Ser
  52. Glossina fuscipes fuscipes tRNA
  53. Glossina fuscipes (Tsetse fly) tRNA-Ser
  54. Glossina morsitans morsitans tRNA tRNA-Ser
  55. Glossina pallidipes tRNA tRNA-Ser
  56. Glossina palpalis gambiensis tRNA tRNA-Ser
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...