v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles coluzzii (Mosquito) tRNA tRNA-Ser secondary structure diagram

Anopheles coluzzii (Mosquito) tRNA tRNA-Ser URS000039EE20_1518534

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Aedes albopictus tRNA tRNA-Ser
  2. Anopheles arabiensis tRNA
  3. Anopheles atroparvus tRNA
  4. Anopheles culicifacies tRNA tRNA-Ser
  5. Anopheles dirus (Mosquito) tRNA tRNA-Ser
  6. Anopheles epiroticus tRNA tRNA-Ser
  7. Anopheles farauti tRNA tRNA-Ser
  8. Anopheles funestus tRNA-Ser for anticodon AGA
  9. Anopheles gambiae tRNA tRNA-Ser
  10. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1, tRNA-Ser-AGA-2-2)
  11. Anopheles melas tRNA tRNA-Ser
  12. Anopheles merus tRNA tRNA-Ser
  13. Anopheles minimus tRNA
  14. Anopheles quadriannulatus tRNA tRNA-Ser
  15. Anopheles sinensis tRNA tRNA-Ser
  16. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Ser
  17. Aromia moschata tRNA-Ser
  18. Drosophila albomicans (Fruit fly) transfer RNA serine (anticodon AGA)
  19. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  20. Drosophila arizonae (Fruit fly) tRNA-Ser
  21. Drosophila biarmipes (Fruit fly) transfer RNA serine (anticodon AGA)
  22. Drosophila busckii (Fruit fly) tRNA-Ser
  23. Drosophila elegans (Fruit fly) tRNA-Ser
  24. Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  25. Drosophila eugracilis (Fruit fly) tRNA-Ser
  26. Drosophila grimshawi tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  27. Drosophila gunungcola (Fruit fly) transfer RNA serine (anticodon AGA)
  28. Drosophila hydei (Fruit fly) tRNA-Ser
  29. Drosophila innubila (Fruit fly) tRNA-Ser
  30. Drosophila kikkawai (Fruit fly) tRNA-Ser
  31. Drosophila mauritiana (Fruit fly) tRNA-Ser
  32. Drosophila melanogaster transfer RNA:Serine-AGA 3-1 (Dmel_CR32612, Dmel_CR32618)
  33. Drosophila miranda (Fruit fly) tRNA-Ser
  34. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  35. Drosophila navojoa (Fruit fly) tRNA-Ser
  36. Drosophila rhopaloa (Fruit fly) tRNA-Ser
  37. Drosophila santomea (Fruit fly) tRNA-Ser
  38. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  39. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1)
  40. Drosophila subpulchrella (Fruit fly) tRNA-Ser
  41. Drosophila suzukii (Fruit fly) tRNA-Ser
  42. Drosophila takahashii (Fruit fly) tRNA-Ser
  43. Drosophila teissieri (Fruit fly) tRNA-Ser
  44. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  45. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-3-1, tRNA-Ser-AGA-3-2)
  46. Glossina austeni tRNA tRNA-Ser
  47. Glossina fuscipes fuscipes tRNA
  48. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Ser
  49. Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser
  50. Glossina palpalis gambiensis tRNA tRNA-Ser
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications