Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-34b-5p URS000037E0D9_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-34b: Mmu-mir-34b is a microRNA that has been studied in various contexts. Primers for mmu-mir-34b were used in a study that investigated its expression in mouse testes [PMC6586303]. Additionally, mmu-mir-34b was confirmed to be differentially expressed in mouse testes using conventional Northern blot analysis [PMC2923610]. Mouse miR-34b (mmu-mir-34b) was used to detect the mouse-specific expression of this microRNA [PMC6761099]. In an A-Myb mutant study, mmu-mir-34b was identified as one of the miRNAs whose expression is significantly reduced [PMC8514520]. The pre-miRNA sequence of mmu-mir-34b was obtained from miRBase [PMC2577349]. For the analysis of mature miRNA expression, cDNA was generated and qPCR was performed using specific primers for mmu-miR-34a, mmu-mir-34b, and mmu-miR-34c [PMC7881031]. In summary, mmu-mir-34b is a microRNA that has been investigated in various studies. It has been shown to be differentially expressed in mouse testes and its specific expression in mice has been detected. Additionally, its reduced expression has been observed in an A-MYB mutant. The pre-miRNA sequence of mmu-mir-34b has been obtained from miRBase. In qPCR analysis for mature miRNA expression, specific primers for mmu-miR-34a, mmu-mir-34b, and mmu-MiR 3c were used.

mRNA interactions 7 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGUAAUUAGCUGAUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Publications