Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-34b-5p URS000037E0D9_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-34b: Rno-mir-34b, a microRNA, is significantly up-regulated in the small intestine of rats after heat treatment, indicating its involvement in heat stress-induced intestinal epithelial cell apoptosis [PMC7699918]. However, the specific mechanism by which this occurs is still unclear [PMC7699918]. Dysregulation of five miRNAs (rno-miR-214, rno-miR-99a, rno-miR-363*, rno-miR-100, and rno-miR-340–5p) at 24 hours and six miRNAs (rno-mir-34b, rno-miR-500, rno-miR-24-1*, rno-miR-29b, rno-miR-199a-3p, and rno-let-7a) at 48 hours after heat treatment has been observed [PMC5856749]. Bioinformatics databases have predicted SLC4A1 as a potential target gene for several miRNAs, including rno-mir-34b [PMC5748115]. Additionally, quantitative real-time PCR analysis has been conducted to validate changes in the expression levels of six miRNAs, including rno-miR-378, rno-miR-182, rno-miR-21, rno-miR-34a, rno-mir-34b, and rno-miR-34c [PMC4456708].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGUAAUUAGCUGAUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Publications