Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-92a URS00003768C5_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-92a: Ssc-mir-92a is a highly expressed muscle-related miRNA [PMC4410957]. It is one of the 23 miRNAs with the highest expression, with a normalized read count over 10,000 RPM [PMC4410957]. Ssc-mir-92a is also one of the top 20 most abundant miRNAs in liver samples [PMC6856533]. It has been found to be differentially expressed in various studies, including in the kidney miRNAome [PMC3555835], in reproductive-related pathways [PMC5155628], and in porcine miRNAs treated with SFN [PMC9179638]. Ssc-mir-92a has been associated with various biological processes and pathways, including muscle development and regulation of reproduction-related genes. It has been found to be upregulated in different conditions, such as during muscle development and reproductive processes. Additionally, ssc-mir-92a has been shown to target genes involved in signaling pathways such as GnRH, Wnt, p53, mTOR, and MAPK signaling pathways [PMC7531090]. Overall, ssc-mir-92a plays a significant role in muscle-related processes and regulation of reproduction-related genes.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUGCACUUGUCCCGGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 69 other species

  1. Alligator mississippiensis (American alligator) ami-miR-92a-3p
  2. Anolis carolinensis aca-miR-92a
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-92
  4. Bos taurus bta-miR-92a
  5. Callithrix jacchus cja-miR-92a
  6. Callorhinchus milii Cmi-Mir-92-P1c_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-92a
  8. Capra hircus (goat) chi-miR-92a-3p
  9. Cavia porcellus cpo-miR-92a-3p
  10. Cervus elaphus cel-miR-92a
  11. Chrysemys picta bellii Cpi-Mir-92-P1a_3p (mature (guide))
  12. Columba livia (rock pigeon) cli-miR-92-3p
  13. Cricetulus griseus cgr-miR-92a-3p
  14. Cyprinus carpio ccr-miR-92a
  15. Danio rerio (zebrafish) dre-miR-92a-3p
  16. Dasypus novemcinctus dno-miR-92a-3p
  17. Daubentonia madagascariensis (aye-aye) dma-miR-92a
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P1c_3p (mature (guide))
  19. Equus caballus eca-miR-92a
  20. Gadus morhua Gmo-Mir-92-P1a1_3p (mature (guide))
  21. Gallus gallus Gga-Mir-92-P1c_3p (mature (guide))
  22. Gekko japonicus Gja-Mir-92-P1c_3p (mature (guide))
  23. Gorilla gorilla gorilla ggo-miR-92 (MIR92-1)
  24. Gorilla gorilla ggo-miR-92
  25. Haplochromis burtoni abu-miR-92a
  26. Homo sapiens hsa-miR-92a-3p
  27. Ictalurus punctatus (channel catfish) ipu-miR-92a
  28. Lagothrix lagotricha (brown woolly monkey) lla-miR-92
  29. Latimeria chalumnae Lch-Mir-92-P1a_3p (mature (guide))
  30. Lemur catta lca-miR-92
  31. Lepisosteus oculatus Loc-Mir-92-P1a_3p (mature (guide))
  32. Macaca mulatta (Rhesus monkey) mml-miR-92a-3p
  33. Macaca nemestrina (pig-tailed macaque) mne-miR-92
  34. Maylandia zebra (zebra mbuna) mze-miR-92a
  35. Microcaecilia unicolor Mun-Mir-92-P1a_3p (mature (guide))
  36. Microcebus murinus (gray mouse lemur) mmr-miR-92b
  37. Monodelphis domestica mdo-miR-92a-3p
  38. Monopterus albus (swamp eel) Mal-Mir-92-P1a1_3p (mature (guide))
  39. Mus musculus (house mouse) Mmu-Mir-92-P1a_3p (mature (guide))
  40. Neolamprologus brichardi (lyretail cichlid) nbr-miR-92a
  41. Nomascus leucogenys nle-miR-92a
  42. Ophiophagus hannah oha-miR-92a
  43. Oreochromis niloticus oni-miR-92a
  44. Ornithorhynchus anatinus oan-miR-92a-3p
  45. Oryctolagus cuniculus ocu-miR-92a-3p
  46. Otolemur garnettii oga-miR-92a
  47. Pan paniscus (pygmy chimpanzee) ppa-miR-92a
  48. Pan troglodytes ptr-miR-92
  49. Papio hamadryas pha-miR-92a
  50. Penaeus japonicus miR-92a
  51. Petromyzon marinus (sea lamprey) Pma-Mir-92-P1h_3p (mature (guide))
  52. Pongo pygmaeus ppy-miR-92
  53. Pteropus alecto pal-miR-92a-3p
  54. Pundamilia nyererei pny-miR-92
  55. Python bivittatus pbv-miR-92a-3p
  56. Rattus norvegicus Rno-Mir-92-P1a_3p (mature (guide))
  57. Saguinus labiatus sla-miR-92
  58. Saimiri boliviensis boliviensis sbo-miR-92a
  59. Salmo salar (Atlantic salmon) ssa-miR-92a-3p
  60. Sarcophilus harrisii Sha-Mir-92-P1c_3p (mature (guide))
  61. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1c_3p (mature (guide))
  62. Sphenodon punctatus (tuatara) Spt-Mir-92-P1c_3p (mature (guide))
  63. Taeniopygia guttata tgu-miR-92-3p
  64. Takifugu rubripes fru-miR-92
  65. Tetraodon nigroviridis tni-miR-92
  66. Tor tambroides (Thai mahseer) miR-92a-3p
  67. Tupaia chinensis tch-miR-92a-3p
  68. Xenopus laevis (African clawed frog) xla-miR-92a-3p
  69. Xenopus tropicalis Xtr-Mir-92-P1c_3p (mature (guide))
Publications