Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-92a URS00003768C5_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-92a: Eca-mir-92a is an orthologous pre-miRNA that is part of a group of miRNAs, including eca-mir-19b, eca-mir-20a, eca-mir-19a, eca-mir-18a, and eca-mir-17 [PMC3005926]. In a study comparing plasma and synovial fluid (SF), seven miRNAs were found to be differentially expressed (DE), including eca-miR-451, eca-miR-25, eca-miR-215, eca-mir-92a, eca-miR-let7c, eca-miR-486-5p, and eca-miR23a [PMC9393553]. These miRNAs were also found to be DE in plasma and SF-derived extracellular vesicles (EVs) when comparing different time points [PMC9393553]. Ten of these miRNAs were identified in multiple pairwise comparisons [PMC9393553]. Additionally, four snoRNAs (U3, snord15 snord46 and snord58) were identified temporally between specific time points [PMC9393553]. Among the highly expressed miRNAs in the total counts analyzed in the study (86% of total counts), the top five included ecamiR4865p ,eca mir92a ,eca mir191a ,eca mir4235p ,and ica mir148 a[PMC5748701]. [PMC3005926] - Liang et al. "Identification of differentially expressed microRNA between synovial tissue-derived mesenchymal stem cells from osteoarthritis patients and donor matched healthy controls" - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3005926/ [PMC9393553] - Li et al. "Identification of synovial fluid microRNA signature in knee osteoarthritis: differentiating early- and late-stage knee osteoarthritis" - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9393553/ [PMC5748701] - Li et al. "Identification of synovial fluid microRNA signature in knee osteoarthritis: differentiating early- and late-stage knee osteoarthritis" - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5748701/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUGCACUUGUCCCGGCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 69 other species

  1. Alligator mississippiensis (American alligator) ami-miR-92a-3p
  2. Anolis carolinensis aca-miR-92a
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-92
  4. Bos taurus bta-miR-92a
  5. Callithrix jacchus cja-miR-92a
  6. Callorhinchus milii Cmi-Mir-92-P1c_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-92a
  8. Capra hircus (goat) chi-miR-92a-3p
  9. Cavia porcellus cpo-miR-92a-3p
  10. Cervus elaphus cel-miR-92a
  11. Chrysemys picta bellii Cpi-Mir-92-P1a_3p (mature (guide))
  12. Columba livia (rock pigeon) cli-miR-92-3p
  13. Cricetulus griseus cgr-miR-92a-3p
  14. Cyprinus carpio ccr-miR-92a
  15. Danio rerio (zebrafish) dre-miR-92a-3p
  16. Dasypus novemcinctus dno-miR-92a-3p
  17. Daubentonia madagascariensis (aye-aye) dma-miR-92a
  18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P1c_3p (mature (guide))
  19. Gadus morhua Gmo-Mir-92-P1a1_3p (mature (guide))
  20. Gallus gallus Gga-Mir-92-P1c_3p (mature (guide))
  21. Gekko japonicus Gja-Mir-92-P1c_3p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-92 (MIR92-1)
  23. Gorilla gorilla ggo-miR-92
  24. Haplochromis burtoni abu-miR-92a
  25. Homo sapiens hsa-miR-92a-3p
  26. Ictalurus punctatus (channel catfish) ipu-miR-92a
  27. Lagothrix lagotricha (brown woolly monkey) lla-miR-92
  28. Latimeria chalumnae Lch-Mir-92-P1a_3p (mature (guide))
  29. Lemur catta lca-miR-92
  30. Lepisosteus oculatus Loc-Mir-92-P1a_3p (mature (guide))
  31. Macaca mulatta (Rhesus monkey) mml-miR-92a-3p
  32. Macaca nemestrina (pig-tailed macaque) mne-miR-92
  33. Maylandia zebra (zebra mbuna) mze-miR-92a
  34. Microcaecilia unicolor Mun-Mir-92-P1a_3p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-miR-92b
  36. Monodelphis domestica mdo-miR-92a-3p
  37. Monopterus albus (swamp eel) Mal-Mir-92-P1a1_3p (mature (guide))
  38. Mus musculus (house mouse) Mmu-Mir-92-P1a_3p (mature (guide))
  39. Neolamprologus brichardi (lyretail cichlid) nbr-miR-92a
  40. Nomascus leucogenys nle-miR-92a
  41. Ophiophagus hannah oha-miR-92a
  42. Oreochromis niloticus oni-miR-92a
  43. Ornithorhynchus anatinus oan-miR-92a-3p
  44. Oryctolagus cuniculus ocu-miR-92a-3p
  45. Otolemur garnettii oga-miR-92a
  46. Pan paniscus (pygmy chimpanzee) ppa-miR-92a
  47. Pan troglodytes ptr-miR-92
  48. Papio hamadryas pha-miR-92a
  49. Penaeus japonicus miR-92a
  50. Petromyzon marinus (sea lamprey) Pma-Mir-92-P1h_3p (mature (guide))
  51. Pongo pygmaeus ppy-miR-92
  52. Pteropus alecto pal-miR-92a-3p
  53. Pundamilia nyererei pny-miR-92
  54. Python bivittatus pbv-miR-92a-3p
  55. Rattus norvegicus Rno-Mir-92-P1a_3p (mature (guide))
  56. Saguinus labiatus sla-miR-92
  57. Saimiri boliviensis boliviensis sbo-miR-92a
  58. Salmo salar (Atlantic salmon) ssa-miR-92a-3p
  59. Sarcophilus harrisii Sha-Mir-92-P1c_3p (mature (guide))
  60. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1c_3p (mature (guide))
  61. Sphenodon punctatus (tuatara) Spt-Mir-92-P1c_3p (mature (guide))
  62. Sus scrofa (pig) ssc-miR-92a
  63. Taeniopygia guttata tgu-miR-92-3p
  64. Takifugu rubripes fru-miR-92
  65. Tetraodon nigroviridis tni-miR-92
  66. Tor tambroides (Thai mahseer) miR-92a-3p
  67. Tupaia chinensis tch-miR-92a-3p
  68. Xenopus laevis (African clawed frog) xla-miR-92a-3p
  69. Xenopus tropicalis Xtr-Mir-92-P1c_3p (mature (guide))
Publications