v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Polistes canadensis pca-miR-981-3p secondary structure diagram

Polistes canadensis pca-miR-981-3p URS00003674BD_91411

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCGUUGUCGACGAAACCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-981
  2. Anopheles gambiae (African malaria mosquito) Aga-Mir-76_3p (mature (guide))
  3. Bactrocera dorsalis bdo-miR-981
  4. Blattella germanica (German cockroach) Bge-Mir-76_3p (mature (guide))
  5. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-981
  6. Cochliomyia macellaria mature cma-miR-981
  7. Culex quinquefasciatus cqu-miR-981
  8. Daphnia magna Dma-Mir-76_3p (mature (guide))
  9. Daphnia pulex dpu-miR-981
  10. Diachasmimorpha longicaudata Dlo-Mir-76_3p (mature (guide))
  11. Dinoponera quadriceps dqu-miR-981-3p
  12. Drosophila ananassae Dan-Mir-76_3p (mature (guide))
  13. Drosophila melanogaster (fruit fly) dme-miR-981-3p
  14. Drosophila mojavensis Dmo-Mir-76_3p (mature (guide))
  15. Drosophila pseudoobscura dps-miR-981-3p
  16. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330793_df_nrg
  17. Drosophila simulans Dsi-Mir-76_3p (mature (guide))
  18. Drosophila virilis dvi-miR-981-3p
  19. Drosophila yakuba Dya-Mir-76_3p (mature (guide))
  20. Glossina pallidipes (tsetse fly) Gpa-Mir-76_3p (mature (guide))
  21. Heliconius melpomene hme-miR-981
  22. Manduca sexta (tobacco hornworm) mse-miR-981
  23. Tribolium castaneum (red flour beetle) tca-miR-981
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...