Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bactrocera dorsalis (oriental fruit fly) bdo-miR-981 URS00003674BD_27457

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCGUUGUCGACGAAACCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Aedes aegypti aae-miR-981
  2. Blattella germanica (German cockroach) Bge-Mir-76_3p (mature (guide))
  3. Cochliomyia hominivorax mature cho-miR-981
  4. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-981
  5. Culex quinquefasciatus cqu-miR-981
  6. Daphnia magna Dma-Mir-76_3p (mature (guide))
  7. Daphnia pulex dpu-miR-981
  8. Dinoponera quadriceps dqu-miR-981-3p
  9. Drosophila ananassae Dan-Mir-76_3p (mature (guide))
  10. Drosophila melanogaster (fruit fly) dme-miR-981-3p
  11. Drosophila mojavensis Dmo-Mir-76_3p (mature (guide))
  12. Drosophila pseudoobscura dps-miR-981-3p
  13. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330793_df_nrg
  14. Drosophila simulans Dsi-Mir-76_3p (mature (guide))
  15. Drosophila virilis dvi-miR-981-3p
  16. Drosophila yakuba Dya-Mir-76_3p (mature (guide))
  17. Heliconius melpomene (postman butterfly) hme-miR-981
  18. Manduca sexta mse-miR-981
  19. Polistes canadensis pca-miR-981-3p
  20. Tribolium castaneum tca-miR-981