v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-981 URS00003674BD_7159

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aae-mir-981: Aae-mir-981 is a crucial hub gene involved in three important chitin metabolism pathways that are highly enriched in all developmental stages [PMC9878986]. It is a node with the highest connectivity in the regulatory network of "alanine, aspartate, and glutamate metabolism" [PMC9878986]. Aae-mir-981, along with aae-miR-375, is conserved in all developmental stages and can be targeted to disrupt the normal molting process and control mosquitoes and mosquito-borne diseases [PMC9878986]. It has the highest connective degree among all nodes [PMC9878986]. A subnetwork of aae-mir-981 consists of 277 nodes (7 circRNAs, 268 lncRNAs, and 1 mRNA) with 276 edges [PMC9878986]. Additionally, Wolbachia infection induces the expression of aae-mir-981 and downregulates importin β-4 in wMelPop-CLA infected Aag2 cells [PMC8261290]. The subnetwork of aae-miR-375 and aae-mir-981 provides valuable information for exploring their extensive regulatory roles as hub genes [PMC9878986]. These findings highlight the importance of aae-mir-981 in chitin metabolism pathways and its potential as a target for mosquito control strategies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCGUUGUCGACGAAACCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-981
  2. Blattella germanica (German cockroach) Bge-Mir-76_3p (mature (guide))
  3. Cochliomyia hominivorax mature cho-miR-981
  4. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-981
  5. Culex quinquefasciatus cqu-miR-981
  6. Daphnia magna Dma-Mir-76_3p (mature (guide))
  7. Daphnia pulex dpu-miR-981
  8. Dinoponera quadriceps dqu-miR-981-3p
  9. Drosophila ananassae Dan-Mir-76_3p (mature (guide))
  10. Drosophila melanogaster (fruit fly) dme-miR-981-3p
  11. Drosophila mojavensis Dmo-Mir-76_3p (mature (guide))
  12. Drosophila pseudoobscura dps-miR-981-3p
  13. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330793_df_nrg
  14. Drosophila simulans Dsi-Mir-76_3p (mature (guide))
  15. Drosophila virilis dvi-miR-981-3p
  16. Drosophila yakuba Dya-Mir-76_3p (mature (guide))
  17. Heliconius melpomene (postman butterfly) hme-miR-981
  18. Manduca sexta mse-miR-981
  19. Polistes canadensis pca-miR-981-3p
  20. Tribolium castaneum tca-miR-981
 Publications