Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nezara viridula (southern green stink bug) tRNA secondary structure diagram

Nezara viridula (southern green stink bug) tRNA URS000035EE7E_85310

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 718 other species

  1. Acanthochromis polyacanthus tRNA
  2. Accipiter nisus (Eurasian sparrowhawk) tRNA
  3. Acinonyx jubatus (cheetah) tRNA
  4. Acipenser ruthenus (sterlet) tRNA
  5. Acrocephalus arundinaceus (great reed warbler) tRNA
  6. Acromyrmex charruanus tRNA
  7. Acromyrmex echinatior tRNA-Gln
  8. Acromyrmex heyeri tRNA
  9. Acropora cervicornis tRNA-Gln
  10. Acropora millepora (Stony coral) tRNA-Gln
  11. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  12. Aegithalos caudatus tRNA
  13. Aegotheles bennettii tRNA
  14. Agrilus planipennis tRNA-Gln
  15. Ailuropoda melanoleuca tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  16. Albula glossodonta (roundjaw bonefish) tRNA
  17. Albula goreensis tRNA
  18. Alligator mississippiensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  19. Alligator sinensis (Chinese alligator) tRNA
  20. Amazona aestiva tRNA
  21. Amazona collaria (yellow-billed parrot) tRNA
  22. Amazona guildingii tRNA
  23. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011492.1
  24. Ameca splendens tRNA-Gln
  25. Ameiurus melas tRNA
  26. Amphiprion ocellaris (clown anemonefish) tRNA
  27. Amphiprion percula tRNA
  28. Amyelois transitella (Moths) transfer RNA glutamine (anticodon UUG)
  29. Anabarilius grahami tRNA
  30. Anabas testudineus tRNA
  31. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  32. Anas zonorhyncha tRNA
  33. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003640.1
  34. Anguilla anguilla (European eel) tRNA
  35. Anniella stebbinsi tRNA-Gln
  36. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  37. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Gln
  38. Anseranas semipalmata (magpie goose) tRNA
  39. Anser brachyrhynchus (pink-footed goose) tRNA
  40. Anser cygnoides (Chinese goose) tRNA
  41. Anthoscopus minutus tRNA
  42. Aotus nancymaae (Ma's night monkey) tRNA
  43. Aphelocoma coerulescens (scrub jay) tRNA
  44. Apis cerana cerana tRNA
  45. Apis dorsata tRNA-Gln
  46. Apis florea tRNA-Gln
  47. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  48. Aplysia californica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 10)
  49. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  50. Apteryx owenii (little spotted kiwi) tRNA
  51. Aquila chrysaetos chrysaetos tRNA
  52. Arctogadus glacialis (Arctic cod) tRNA-Gln
  53. Ardeotis kori tRNA
  54. Arenaria interpres (ruddy turnstone) tRNA
  55. Aromia moschata tRNA-Gln
  56. Asarcornis scutulata tRNA
  57. Asbolus verrucosus (desert ironclad beetle) tRNA
  58. Astyanax mexicanus tRNA
  59. Ataeniobius toweri tRNA-Gln
  60. Athalia rosae misc RNA ENSAEAG00005004799.1
  61. Atlantisia rogersi (inaccessible island rail) tRNA
  62. Atractosteus spatula (alligator gar) tRNA
  63. Atrichornis clamosus tRNA
  64. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616953-2
  65. Atta colombica tRNA
  66. Austrofundulus limnaeus tRNA
  67. Aythya fuligula (tufted duck) tRNA
  68. Bagarius yarrelli (goonch) tRNA
  69. Balaeniceps rex (shoebill) tRNA
  70. Balaenoptera acutorostrata scammoni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  71. Balaenoptera musculus (Blue whale) tRNA
  72. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  73. Baryphthengus martii tRNA
  74. Betta splendens (Siamese fighting fish) tRNA
  75. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026504.1
  76. Biomphalaria glabrata tRNA
  77. Biomphalaria pfeifferi tRNA-Gln
  78. Bison bison bison (north american plains bison) tRNA
  79. Blattella germanica tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 11)
  80. Bombus affinis (Rusty patched bumble bee) transfer RNA glutamine (anticodon UUG)
  81. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  82. Bombus impatiens (Common eastern bumblebee) tRNA-Gln
  83. Bombus terrestris (Bombus terrestris) misc RNA ENSBTSG00005036439.1
  84. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  85. Bombus vosnesenskii tRNA
  86. Bombycilla garrulus tRNA
  87. Bombyx mandarina (Wild silkworm) tRNA-Gln
  88. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  89. Boreogadus saida tRNA-Gln
  90. Bos grunniens (domestic yak) tRNA
  91. Bos mutus Bos grunniens mutus tRNA
  92. Bos indicus tRNA
  93. Bos indicus x Bos taurus (hybrid cattle) tRNA
  94. Bos taurus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  95. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  96. Branchiostoma belcheri (Belcher's lancelet) tRNA
  97. Branchiostoma floridae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  98. Branchiostoma lanceolatum (Amphioxus) transfer RNA glutamine (anticodon UUG)
  99. Brenthis ino (lesser marbled fritillary) tRNA
  100. Bucco capensis (collared puffbird) tRNA
  101. Bucorvus abyssinicus tRNA
  102. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  103. Burhinus bistriatus tRNA
  104. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  105. Alaudala cheleensis Calandrella cheleensis tRNA
  106. Calcarius ornatus tRNA
  107. Callaeas wilsoni (north island kokako) tRNA
  108. Callipepla squamata tRNA
  109. Callithrix jacchus tRNA-Gln (TTG) (tRNA-Gln-TTG-4-1)
  110. Callorhinchus milii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  111. Callorhinus ursinus (northern fur seal) tRNA
  112. Caloenas nicobarica tRNA
  113. Calypte anna (Anna's hummingbird) tRNA
  114. Camarhynchus parvulus tRNA
  115. Camelus bactrianus (Bactrian camel) tRNA
  116. Camelus dromedarius (Arabian camel) tRNA
  117. Camelus ferus tRNA
  118. Camponotus floridanus tRNA-Gln
  119. Campylorhamphus procurvoides tRNA
  120. Candidula unifasciata tRNA
  121. Canis lupus dingo (dingo) tRNA
  122. Canis lupus familiaris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  123. Capra hircus (goat) tRNA
  124. Caranx melampygus tRNA-OTHER
  125. Carassius auratus (goldfish) tRNA
  126. Cardinalis cardinalis tRNA
  127. Carlito syrichta tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  128. Castor canadensis (American beaver) tRNA
  129. Cataglyphis hispanica (Desert ant) transfer RNA glutamine (anticodon UUG)
  130. Catagonus wagneri (Chacoan peccary) tRNA
  131. Catharus fuscescens tRNA
  132. Catharus ustulatus tRNA
  133. Cavia porcellus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  134. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  135. Cebus imitator (Panamanian white-faced capuchin) tRNA
  136. Centropus unirufus tRNA
  137. Centruroides sculpturatus (Bark scorpion) tRNA-Gln
  138. Cephus cinctus (wheat stem sawfly) tRNA
  139. Cepphus grylle tRNA
  140. Ceratotherium simum simum tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  141. Cercocebus atys (sooty mangabey) tRNA
  142. Tychaedon coryphoeus Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  143. Cervus elaphus hippelaphus tRNA
  144. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  145. Cettia cetti tRNA
  146. Ceuthmochares aereus tRNA
  147. Chaetorhynchus papuensis (pygmy drongo) tRNA
  148. Channa argus (snakehead) tRNA
  149. Chanos chanos (milkfish) tRNA
  150. Characodon lateralis tRNA-Gln
  151. Chauna torquata (southern screamer) tRNA
  152. Chelonia mydas (green seaturtle) tRNA
  153. Chelonus insularis tRNA-Gln
  154. Chelydra serpentina (snapping turtle) tRNA
  155. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  156. Chinchilla lanigera tRNA
  157. Chionis minor (black-faced sheathbill) tRNA
  158. Chlorocebus sabaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  159. Chloropsis cyanopogon tRNA
  160. Chloropsis hardwickii tRNA
  161. Choloepus hoffmanni tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  162. Chordeiles acutipennis (lesser nighthawk) tRNA
  163. Vaccinia virus GLV-1h68 chr17.trna16-GlnTTG from Vaccinia virus GLV-1h68 (PDB 8C8H, chain U)
  164. Chrysemys picta bellii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  165. Chrysochloris asiatica tRNA
  166. Chrysodeixis includens tRNA
  167. Cimex lectularius (Bed bug) tRNA-Gln
  168. Cinara cedri tRNA
  169. Cinclus mexicanus tRNA
  170. Circaetus pectoralis tRNA
  171. Cisticola juncidis tRNA
  172. Clarias magur (asian catfish) tRNA
  173. Cloeon dipterum tRNA
  174. Cnephaeus nilssonii tRNA-Gln
  175. Colinus virginianus (northern bobwhite) tRNA
  176. Collichthys lucidus tRNA
  177. Colobus angolensis palliatus tRNA
  178. Columba livia (Rock pigeon) tRNA
  179. Conger conger tRNA
  180. Copsychus sechellarum tRNA
  181. Coptotermes formosanus (Formosan subterranean termite) tRNA
  182. Cordylochernes scorpioides tRNA-Gln
  183. Corvus brachyrhynchos (American crow) tRNA
  184. Corvus moneduloides (new caledonian crow) tRNA
  185. Corythaixoides concolor (grey go-away-bird) tRNA
  186. Cottoperca gobio tRNA
  187. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  188. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  189. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  190. Crassostrea virginica tRNA-Gln
  191. Crenichthys baileyi tRNA-Gln
  192. Cricetulus griseus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  193. Crocodylus porosus (Australian saltwater crocodile) tRNA
  194. Crocuta crocuta (spotted hyena) tRNA
  195. Cryptotermes secundus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  196. Crypturellus soui tRNA
  197. Crypturellus undulatus tRNA
  198. Cuculus canorus (common cuckoo) tRNA
  199. Cyanistes caeruleus tRNA
  200. Cyclopterus lumpus tRNA
  201. Cydia pomonella (The codling moth) transfer RNA glutamine (anticodon UUG)
  202. Cynoglossus semilaevis (tongue sole) tRNA
  203. Cyphomyrmex costatus tRNA
  204. Cyprinodon variegatus tRNA
  205. Cyprinus carpio carpio tRNA
  206. Cyprinus carpio (common carp) tRNA
  207. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  208. Danaus chrysippus (African queen) tRNA
  209. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018329.1
  210. Danaus plexippus plexippus (Monarch butterfly) tRNA-Gln
  211. Danionella cerebrum tRNA-Gln
  212. Danionella translucida tRNA
  213. Danio rerio tRNA-Gln (TTG) (tRNA-Gln-TTG-4 1 to 3)
  214. Dasyornis broadbenti (rufous bristle-bird) tRNA
  215. Dasypus novemcinctus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  216. Daubentonia madagascariensis tRNA-Gln
  217. Delphinapterus leucas (beluga whale) tRNA
  218. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  219. Denticeps clupeoides (denticle herring) tRNA
  220. Dermacentor andersoni transfer RNA glutamine (anticodon UUG)
  221. Dermacentor silvarum transfer RNA glutamine (anticodon UUG)
  222. Diachasma alloeum tRNA
  223. Diaphorina citri (Asian citrus psyllid) tRNA-Gln
  224. Diatraea saccharalis (sugarcane borer) tRNA
  225. Dicentrarchus labrax tRNA
  226. Dinoponera quadriceps (south american ant) tRNA
  227. Dipodomys ordii tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  228. Dissostichus eleginoides tRNA-Gln
  229. Dissostichus mawsoni tRNA
  230. Diuraphis noxia tRNA-Gln
  231. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  232. Donacobius atricapilla tRNA
  233. Dromaius novaehollandiae (emu) tRNA
  234. Drymodes brunneopygia tRNA
  235. Dryococelus australis tRNA-OTHER
  236. Dryoscopus gambensis tRNA
  237. Dufourea novaeangliae (Bee) tRNA-Gln
  238. Echeneis naucrates (live sharksucker) tRNA
  239. Echinops telfairi tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  240. Edolisoma coerulescens tRNA
  241. Electrophorus electricus (electric eel) tRNA
  242. Elysia chlorotica (eastern emerald elysia) tRNA
  243. Emberiza fucata tRNA
  244. Enhydra lutris kenyoni tRNA
  245. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  246. Eptatretus burgeri (inshore hagfish) tRNA
  247. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  248. Equus asinus (ass) tRNA
  249. Equus caballus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  250. Erinaceus europaeus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  251. Erpetoichthys calabaricus (reedfish) tRNA
  252. Erpornis zantholeuca tRNA
  253. Erysiphe pulchra tRNA
  254. Erythrocercus mccallii tRNA
  255. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  256. Etheostoma spectabile (orangethroat darter) tRNA
  257. Eubucco bourcierii (red-headed barbet) tRNA
  258. Eudromia elegans (elegant crested-tinamou) tRNA
  259. Eufriesea mexicana (Mexican orchid bee) tRNA-Gln
  260. Eumeta japonica tRNA
  261. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  262. Eurystomus gularis tRNA
  263. Exocentrus adspersus tRNA-OTHER
  264. Falco tinnunculus (common kestrel) tRNA
  265. Felis catus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  266. Ficedula albicollis tRNA
  267. Fopius arisanus tRNA
  268. Frankliniella occidentalis (western flower thrips) tRNA
  269. Fregetta grallaria tRNA
  270. Frieseomelitta varia tRNA
  271. Furnarius figulus tRNA
  272. Gadus morhua 'NCC' tRNA-Gln
  273. Gadus morhua tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  274. Galbula dea tRNA
  275. Galemys pyrenaicus tRNA
  276. Galleria mellonella (greater wax moth) tRNA
  277. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  278. Gallus gallus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  279. Gambusia affinis (western mosquitofish) tRNA
  280. Gammaproteobacteria bacterium tRNA-Gln
  281. Gasterosteus aculeatus tRNA
  282. Gekko kuhli tRNA-Gln
  283. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  284. Geococcyx californianus tRNA
  285. Geospiza fortis tRNA
  286. Glareola pratincola tRNA
  287. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  288. Goodea atripinnis tRNA-Gln
  289. Gopherus agassizii (desert tortoise) tRNA
  290. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  291. Gorilla gorilla gorilla tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  292. Grallaria varia (variegated antpitta) tRNA
  293. Grantiella picta tRNA
  294. Gulo gulo (wolverine) tRNA
  295. Gymnodraco acuticeps tRNA
  296. Gymnothorax javanicus tRNA-Gln
  297. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Gln
  298. Halcyon senegalensis tRNA
  299. Haliotis rubra tRNA-Gln
  300. Haliotis rufescens (Red abalone) tRNA-Gln
  301. Halyomorpha halys (Brown marmorated stink bug) tRNA-Gln
  302. Haplochromis burtoni tRNA
  303. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  304. Heliconius melpomene tRNA HMEL014838
  305. Helicoverpa armigera transfer RNA glutamine (anticodon UUG)
  306. Helicoverpa zea (Corn earworm) tRNA-Gln
  307. Heliothis virescens (tobacco budworm) tRNA
  308. Hemibagrus wyckioides tRNA
  309. Herpetotheres cachinnans tRNA
  310. Heterocephalus glaber tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  311. Heterotrigona itama tRNA
  312. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  313. Hipposideros armiger tRNA
  314. Hirundo rustica rustica tRNA
  315. Homalodisca vitripennis tRNA-Gln
  316. Homo sapiens tRNA-Gln (anticodon TTG) 1-1 (TRQ-TTG1-1)
  317. Horornis vulcanius tRNA
  318. Hyalomma asiaticum (Tick) tRNA-Gln for anticodon UUG
  319. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon UUG)
  320. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon UUG)
  321. Hypocryptadius cinnamomeus tRNA
  322. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005010634.1
  323. Ictidomys tridecemlineatus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  324. Ifrita kowaldi (blue-capped ifrita) tRNA
  325. Ignelater luminosus (cucubano) tRNA
  326. Illadopsis cleaveri (blackcap illadopsis) tRNA
  327. Ilyodon furcidens tRNA-Gln
  328. Indicator maculatus tRNA
  329. Inia geoffrensis tRNA-Gln
  330. Irena cyanogastra Irena cyanogaster tRNA
  331. Ischnura elegans (Damselflies) tRNA-Gln
  332. Ixodes persulcatus tRNA-Gln for anticodon UUG
  333. Ixodes scapularis (Black-legged tick) tRNA-Gln
  334. Jacana jacana (wattled jacana) tRNA
  335. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  336. Junco hyemalis (dark-eyed junco) tRNA
  337. Kryptolebias marmoratus (mangrove rivulus) tRNA
  338. Labeo rohita (rohu) tRNA
  339. Labrus bergylta (ballan wrasse) tRNA
  340. Ladona fulva tRNA
  341. Lamprotornis superbus tRNA
  342. Laodelphax striatellus (small brown planthopper) tRNA
  343. Larimichthys crocea tRNA
  344. Larus smithsonianus tRNA
  345. Lasius niger tRNA
  346. Lates calcarifer (barramundi perch) tRNA
  347. Latimeria chalumnae tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  348. Leguminivora glycinivorella (Soybean pod borer) tRNA-Gln
  349. Leiothrix lutea (red-billed leiothrix) tRNA
  350. Lepidothrix coronata tRNA
  351. Lepisosteus oculatus tRNA
  352. Leptobrachium leishanense (Leishan spiny toad) tRNA
  353. Leptocoma aspasia tRNA
  354. Leptonychotes weddellii (Weddell seal) tRNA
  355. Leucopsar rothschildi tRNA
  356. Limulus polyphemus tRNA-Gln
  357. Linepithema humile (Argentine ant) transfer RNA glutamine (anticodon UUG)
  358. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025189.1
  359. Lingula anatina (Lamp shell) tRNA-Gln
  360. Liolophura japonica (Chitons) transfer RNA glutamine (anticodon UUG)
  361. Liparis tanakae tRNA
  362. Lipotes vexillifer (Yangtze River dolphin) tRNA
  363. Helopsaltes ochotensis Locustella ochotensis tRNA
  364. Lonchura striata tRNA
  365. Desmophyllum pertusum Lophelia pertusa tRNA
  366. Lophotis ruficrista tRNA
  367. Loxia curvirostra tRNA
  368. Loxodonta africana tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  369. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  370. Lycocorax pyrrhopterus obiensis tRNA-Gln
  371. Lynx canadensis (Canada lynx) tRNA
  372. Lynx pardinus (Spanish lynx) tRNA
  373. Macaca fascicularis (crab-eating macaque) tRNA
  374. Macaca mulatta tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  375. Macaca nemestrina (pig-tailed macaque) tRNA
  376. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  377. Magallana gigas (Pacific oyster) transfer RNA glutamine (anticodon UUG)
  378. Malurus elegans (Red-winged fairywren) tRNA
  379. Mandrillus leucophaeus (drill) tRNA
  380. Manduca sexta tRNA-Gln
  381. Marmota marmota marmota (Alpine marmot) tRNA
  382. Marmota monax tRNA
  383. Mastacembelus armatus tRNA
  384. Mauremys mutica tRNA
  385. Maylandia zebra (zebra mbuna) tRNA
  386. Megachile rotundata tRNA-Gln
  387. Megalops atlanticus (tarpon) tRNA
  388. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  389. Meleagris gallopavo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  390. Melipona bicolor tRNA
  391. Melipona quadrifasciata tRNA
  392. Melitaea cinxia misc RNA ENSMCXG00005023295.1
  393. Melospiza melodia (song sparrow) tRNA
  394. Menidia menidia (Atlantic silverside) tRNA
  395. Menura novaehollandiae (superb lyrebird) tRNA
  396. Merluccius polli (Benguela hake) tRNA
  397. Mesocricetus auratus (golden hamster) tRNA
  398. Microcaecilia unicolor tRNA
  399. Microcebus murinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  400. Microctonus aethiopoides tRNA
  401. Microctonus hyperodae tRNA
  402. Microplitis demolitor (Parasitoid wasp) transfer RNA glutamine (anticodon UUG)
  403. Microplitis mediator (Endoparasitoid wasp) transfer RNA glutamine (anticodon UUG)
  404. Microtus ochrogaster (prairie vole) tRNA
  405. Mionectes macconnelli (McConnell's flycatcher) tRNA
  406. Mola mola (ocean sunfish) tRNA
  407. Molorchus minor tRNA-OTHER
  408. Molossus molossus (Pallas's mastiff bat) tRNA
  409. Molothrus ater tRNA
  410. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  411. Monodelphis domestica tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  412. Monodon monoceros (narwhal) tRNA
  413. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  414. Moschus moschiferus (Siberian musk deer) tRNA
  415. Muntiacus reevesi (Chinese muntjac) tRNA
  416. Muraenolepis orangiensis (Patagonian moray cod) tRNA
  417. Mus caroli tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  418. Mus musculus castaneus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  419. Mus musculus domesticus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  420. Mus musculus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  421. Mus musculus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  422. Mus pahari tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  423. Mus spicilegus (steppe mouse) tRNA
  424. Mus spretus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  425. Mustela putorius furo tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  426. Myiagra hebetior tRNA
  427. Myotis davidii tRNA
  428. Myotis lucifugus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  429. Myotis myotis tRNA
  430. Myripristis murdjan (pinecone soldierfish) tRNA
  431. Mystacornis crossleyi tRNA
  432. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  433. Nasonia vitripennis (Jewel wasp) tRNA-Gln
  434. Nematostella vectensis tRNA-Gln for anticodon UUG
  435. Neodiprion lecontei tRNA-Gln
  436. Neodiprion pinetum (White pine sawfly) tRNA-Gln
  437. Neodrepanis coruscans (wattled asity) tRNA
  438. Neogobius melanostomus (round goby) tRNA
  439. Neolamprologus brichardi tRNA
  440. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  441. Neopipo cinnamomea tRNA
  442. Neotoma lepida (desert woodrat) tRNA
  443. Neogale vison Neovison vison tRNA
  444. Nesospiza acunhae tRNA
  445. Nicator chloris tRNA
  446. Nilaparvata lugens tRNA-Gln
  447. Nomascus leucogenys tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  448. Nothobranchius furzeri tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  449. Nothoprocta perdicaria tRNA
  450. Notiomystis cincta tRNA
  451. Notodromas monacha tRNA
  452. Notothenia coriiceps (black rockcod) tRNA
  453. Nyctereutes procyonoides (raccoon dog) tRNA
  454. Nyctibius grandis tRNA
  455. Nycticryphes semicollaris tRNA
  456. Nyctiprogne leucopyga tRNA
  457. Nylanderia fulva tRNA
  458. Oceanites oceanicus tRNA
  459. Ochotona princeps tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  460. Octodon degus (degu) tRNA
  461. Odobenus rosmarus divergens (Pacific walrus) tRNA
  462. Odocoileus virginianus texanus tRNA
  463. Onthophagus taurus tRNA-Gln
  464. Onychorhynchus coronatus tRNA
  465. Onychostoma macrolepis tRNA
  466. Ooceraea biroi tRNA-Gln
  467. Operophtera brumata tRNA
  468. Orbicella faveolata (Mountainous star coral) tRNA-Gln
  469. Oreocharis arfaki tRNA
  470. Oreochromis aureus tRNA
  471. Oreochromis niloticus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  472. Oreotrochilus melanogaster tRNA
  473. Oriolus oriolus tRNA
  474. Ornithodoros turicata (Softbacked ticks) transfer RNA glutamine (anticodon UUG)
  475. Ornithorhynchus anatinus (platypus) tRNA
  476. Orthonyx spaldingii (northern chowchilla) tRNA
  477. Orussus abietinus tRNA-Gln
  478. Orycteropus afer afer tRNA
  479. Oryctes borbonicus tRNA
  480. Oryctolagus cuniculus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  481. Oryzias javanicus tRNA
  482. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  483. Oryzias melastigma (Indian medaka) tRNA
  484. Oryzias sinensis tRNA
  485. Ostrea edulis (Mud oyster) transfer RNA glutamine (anticodon UUG)
  486. Otolemur garnettii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  487. Otus sunia (Oriental scops-owl) tRNA
  488. Ovis aries tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  489. Oxyruncus cristatus (sharpbill) tRNA
  490. Pachycephala philippinensis tRNA
  491. Pachyramphus minor tRNA
  492. Pangasianodon gigas tRNA-Gln
  493. Pangasianodon hypophthalmus tRNA
  494. Pangasius djambal tRNA-Gln
  495. Pan paniscus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  496. Panthera leo (lion) tRNA
  497. Panthera tigris altaica (Amur tiger) tRNA
  498. Pan troglodytes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  499. Panurus biarmicus tRNA
  500. Papilio machaon tRNA
  501. Papilio xuthus tRNA
  502. Papio anubis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  503. Sinosuthora webbiana Paradoxornis webbianus tRNA
  504. Pararge aegeria aegeria tRNA
  505. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  506. Arctia plantaginis Parasemia plantaginis tRNA
  507. Parnassius apollo (apollo) tRNA
  508. Patagioenas fasciata monilis tRNA
  509. Pavo cristatus (Indian peafowl) tRNA
  510. Pectinophora gossypiella transfer RNA glutamine (anticodon UUG)
  511. Pediculus humanus corporis tRNA tRNA-Gln
  512. Pelodiscus sinensis tRNA
  513. Pelusios castaneus tRNA
  514. Penelope pileata tRNA
  515. Perca flavescens (yellow perch) tRNA
  516. Perca fluviatilis (European perch) tRNA
  517. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  518. Peromyscus maniculatus sonoriensis tRNA-Gln
  519. Peucedramus taeniatus (olive warbler) tRNA
  520. Phainopepla nitens tRNA
  521. Phascolarctos cinereus (koala) tRNA
  522. Pheucticus melanocephalus tRNA
  523. Phocoena sinus (vaquita) tRNA
  524. Photinus pyralis (Common eastern firefly) tRNA-Gln
  525. Phrynocephalus forsythii tRNA
  526. Phthorimaea operculella tRNA-Gln
  527. Phyllostomus discolor (pale spear-nosed bat) tRNA
  528. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  529. Piaya cayana (squirrel cuckoo) tRNA
  530. Picathartes gymnocephalus tRNA
  531. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  532. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  533. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  534. Pipra filicauda tRNA
  535. Pitta sordida (hooded pitta) tRNA
  536. Platysteira castanea tRNA
  537. Platysternon megacephalum (big-headed turtle) tRNA
  538. Plecturocebus cupreus tRNA-OTHER
  539. Pleuronectes platessa tRNA
  540. Ploceus nigricollis tRNA
  541. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon UUG)
  542. Plutella xylostella tRNA
  543. Pluvianellus socialis (magellanic plover) tRNA
  544. Pocillopora damicornis (Cauliflower coral) tRNA-Gln
  545. Podarcis lilfordi tRNA
  546. Podarcis muralis tRNA
  547. Podargus strigoides (tawny frogmouth) tRNA
  548. Podilymbus podiceps tRNA
  549. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  550. Poecilia formosa tRNA
  551. Poecilia reticulata (guppy) tRNA
  552. Pogona vitticeps (central bearded dragon) tRNA
  553. Pogonomyrmex barbatus tRNA-Gln
  554. Pogonomyrmex californicus tRNA-Gln
  555. Polioptila caerulea tRNA
  556. Polistes canadensis (Red paper wasp) tRNA-Gln
  557. Polistes dominula (European paper wasp) tRNA-Gln
  558. Polistes fuscatus (Common paper wasp) tRNA-Gln
  559. Polyplax serrata tRNA-Gln
  560. Polypterus senegalus tRNA
  561. Pomacea canaliculata (Apple snail) tRNA-Gln
  562. Pomatorhinus ruficollis tRNA
  563. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  564. Pongo abelii tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  565. Potamilus streckersoni tRNA-Gln
  566. Probosciger aterrimus tRNA
  567. Procavia capensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  568. Prolemur simus (greater bamboo lemur) tRNA
  569. Promerops cafer (Cape sugarbird) tRNA
  570. Propithecus coquereli (Coquerel's sifaka) tRNA
  571. Prunella fulvescens tRNA
  572. Prunella himalayana tRNA
  573. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  574. Pseudoatta argentina tRNA
  575. Pseudonaja textilis tRNA
  576. Psilopogon haemacephalus tRNA
  577. Psophia crepitans (common trumpeter) tRNA
  578. Pterocles burchelli tRNA
  579. Pteropus alecto (black flying fox) tRNA
  580. Pteropus vampyrus (large flying fox) tRNA
  581. Pteruthius melanotis tRNA
  582. Puma concolor (puma) tRNA
  583. Pundamilia nyererei tRNA
  584. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  585. Pycnonotus jocosus tRNA
  586. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  587. Quiscalus mexicanus tRNA
  588. Ramphastos sulfuratus tRNA
  589. Rattus norvegicus tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  590. Rhabdornis inornatus tRNA
  591. Rhamnusium bicolor tRNA-Gln
  592. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  593. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  594. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  595. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  596. Rhipicephalus microplus tRNA-Gln
  597. Rhipicephalus sanguineus transfer RNA glutamine (anticodon UUG)
  598. Rhodinocichla rosea tRNA
  599. Rhodnius prolixus (Kissing bug) tRNA tRNA-Gln
  600. Rhopalosiphum maidis tRNA-Gln
  601. Rhopilema esculentum tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  602. Rousettus aegyptiacus (Egyptian rousette) tRNA
  603. Saccoglossus kowalevskii (Acorn worm) tRNA-Gln
  604. Sagittarius serpentarius tRNA
  605. Saimiri boliviensis boliviensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  606. Sakesphorus luctuosus tRNA
  607. Salarias fasciatus (jewelled blenny) tRNA
  608. Sander lucioperca (pike-perch) tRNA
  609. Sapayoa aenigma (broad-billed sapayoa) tRNA
  610. Sarcophilus harrisii (Tasmanian devil) tRNA
  611. Schistocerca americana tRNA-Gln
  612. Schistocerca cancellata (South American locust) transfer RNA glutamine (anticodon UUG)
  613. Schistocerca gregaria (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  614. Schistocerca nitens (Vagrant locust) transfer RNA glutamine (anticodon UUG)
  615. Schistocerca piceifrons (Central American locust) tRNA-Gln
  616. Schistocerca serialis cubense (Grasshoppers) transfer RNA glutamine (anticodon UUG)
  617. Sciurus carolinensis (gray squirrel) tRNA
  618. Sciurus vulgaris (Eurasian red squirrel) tRNA
  619. Scleropages formosus tRNA
  620. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  621. Scophthalmus maximus (turbot) tRNA
  622. Scopus umbretta (hamerkop) tRNA
  623. Scyliorhinus torazame (cloudy catshark) tRNA
  624. Scytalopus superciliaris tRNA
  625. Semnornis frantzii tRNA
  626. Acanthosepion pharaonis Sepia pharaonis tRNA
  627. Serilophus lunatus (silver-breasted broadbill) tRNA
  628. Silurus meridionalis tRNA
  629. Sinocyclocheilus anshuiensis tRNA
  630. Sinocyclocheilus grahami tRNA
  631. Sinocyclocheilus rhinocerous tRNA
  632. Sipha flava (Yellow sugarcane aphid) tRNA-Gln
  633. Sitta europaea (wood nuthatch) tRNA
  634. Solenopsis invicta tRNA-Gln
  635. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  636. Sparus aurata (gilthead seabream) tRNA
  637. Spermophilus dauricus (Daurian ground squirrel) tRNA
  638. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  639. Sphaeramia orbicularis tRNA
  640. Sphaerodactylus townsendi tRNA-Gln
  641. Sphenodon punctatus (tuatara) tRNA
  642. Spizaetus tyrannus (black hawk-eagle) tRNA
  643. Spizella passerina (chipping sparrow) tRNA
  644. Spodoptera exigua (beet armyworm) tRNA
  645. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  646. Spodoptera littoralis tRNA
  647. Spodoptera litura tRNA
  648. Steatornis caripensis (oilbird) tRNA
  649. Stegastes partitus (bicolor damselfish) tRNA
  650. Stegodyphus dumicola tRNA-Gln
  651. Stercorarius parasiticus tRNA
  652. Strigamia maritima tRNA
  653. Strigops habroptila (kakapo) tRNA
  654. Strix occidentalis caurina tRNA
  655. Stylophora pistillata tRNA-Gln
  656. Sula dactylatra tRNA
  657. Suricata suricatta (meerkat) tRNA
  658. Sus scrofa tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  659. Sylvia borin tRNA
  660. Symphalangus syndactylus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  661. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  662. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  663. Taeniopygia guttata tRNA
  664. Takifugu bimaculatus tRNA
  665. Takifugu flavidus tRNA
  666. Takifugu rubripes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1, tRNA-Gln-TTG-1-2)
  667. Temnothorax curvispinosus tRNA
  668. Temnothorax longispinosus tRNA
  669. Tenebrio molitor (yellow mealworm) tRNA
  670. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  671. Tetraodon nigroviridis tRNA
  672. Theropithecus gelada (gelada baboon) tRNA
  673. Thinocorus orbignyianus tRNA
  674. Thrips palmi tRNA-Gln
  675. Tinamus guttatus tRNA
  676. Todus mexicanus (puerto rican tody) tRNA
  677. Toxostoma redivivum tRNA
  678. Trachymyrmex cornetzi tRNA
  679. Trachymyrmex septentrionalis tRNA
  680. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  681. Trialeurodes vaporariorum (Greenhouse whitefly) tRNA-Gln for anticodon UUG
  682. Tribolium castaneum (Red flour beetle) transfer RNA glutamine (anticodon UUG)
  683. Tribolium madens (Black flour beetle) tRNA-Gln
  684. Trichechus manatus latirostris tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  685. Trichogramma brassicae tRNA
  686. Trichogramma pretiosum tRNA-Gln
  687. Tricholaema leucomelas (pied barbet) tRNA
  688. Trichomalopsis sarcophagae tRNA
  689. Trichoplusia ni (cabbage looper) tRNA
  690. Triplophysa rosa (cave loach) tRNA
  691. Triplophysa tibetana tRNA
  692. Tupaia belangeri chinensis Tupaia chinensis (Chinese tree shrew) tRNA
  693. Salvator merianae Tupinambis merianae tRNA
  694. Turnix velox (little buttonquail) tRNA
  695. Tursiops truncatus (bottlenosed dolphin) tRNA
  696. Tyrannus savana (fork-tailed flycatcher) tRNA
  697. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon UUG)
  698. Upupa epops (Eurasian hoopoe) tRNA
  699. Urocolius indicus tRNA
  700. Urocynchramus pylzowi tRNA
  701. Orthopoxvirus vaccinia URQ-UUG1-1 tRNA (72-MER) from Vaccinia virus (PDB 9FPY, chain U)
  702. Ursus americanus (American black bear) tRNA
  703. Ursus maritimus (polar bear) tRNA
  704. Vanessa tameamea tRNA
  705. Varanus komodoensis tRNA
  706. Venturia canescens tRNA-Gln
  707. Vespa mandarinia (Asian giant hornet) tRNA-Gln
  708. Vespula germanica tRNA
  709. Vespula pensylvanica (western yellowjacket) tRNA
  710. Vespula vulgaris tRNA
  711. Vicugna pacos tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1)
  712. Vidua chalybeata tRNA
  713. Vidua macroura tRNA
  714. Vombatus ursinus (common wombat) tRNA
  715. Vulpes vulpes (red fox) tRNA
  716. Xenoophorus captivus tRNA-Gln
  717. Xenotaenia resolanae tRNA-Gln
  718. Xiphophorus maculatus (southern platyfish) tRNA
  719. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  720. Zapornia atra tRNA
  721. Zootermopsis nevadensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 3)
  722. Zophobas morio tRNA
  723. Zosterops borbonicus tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...