Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-1a URS0000348947_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Ascaris suum (pig roundworm) asu-miR-1-3p
  2. Caenorhabditis brenneri cbn-miR-1
  3. Caenorhabditis briggsae cbr-miR-1
  4. Caenorhabditis elegans cel-miR-1-3p
  5. Callorhinchus milii cmi-miR-1-3
  6. Canis lupus familiaris (dog) cfa-miR-1
  7. Danio rerio microRNA miR-1
  8. Gallus gallus (chicken) gga-miR-1a-3p
  9. Gorilla gorilla gorilla ggo-miR-1 (MIR1)
  10. Gorilla gorilla ggo-miR-1
  11. Heligmosomoides polygyrus hpo-miR-1-3p
  12. Mus musculus Mus_musculus piRNA piR-mmu-34030223
  13. Oryzias latipes ola-miR-1-3p
  14. Ovis aries Pri-miR1.2
  15. Pan paniscus ppa-miR-1
  16. Pan troglodytes (chimpanzee) microRNA miR-1-2
  17. Python bivittatus (Burmese python) pbv-miR-1a-3p
  18. Scyliorhinus torazame Sto-Mir-1-P4_3p (mature (guide))
  19. Sus scrofa ssc-miR-1
Publications