Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-1 URS0000348947_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-1: Ssc-mir-1 is a microRNA that has been identified as potentially involved in fibre type regulation [PMC4410957]. Other microRNAs that may also play a role in this regulation include ssc-mir-143-3p, ssc-mir-151, ssc-miR-30b, ssc-miR-340, and ssc-miR-335 [PMC4410957]. For ssc-mir-1 specifically, it has been found to target the myogenic factor 6 (MYF6), FOS-related antigen 2 (FOSL2), and arrestin domain-containing protein 3 (ARRDC3) [PMC6966835]. Additionally, the microRNA ssc-mir-148a has been found to target thioredoxin interacting protein (TXNIP) and fasting-induced gene protein (DEPP1) [PMC6966835]. These findings suggest that these microRNAs may play a role in the regulation of fibre type in an as-yet-unspecified context. Further research is needed to fully understand the mechanisms by which these microRNAs function and their specific roles in fibre type regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Ascaris suum (pig roundworm) asu-miR-1-3p
  2. Caenorhabditis brenneri cbn-miR-1
  3. Caenorhabditis briggsae cbr-miR-1
  4. Caenorhabditis elegans cel-miR-1-3p
  5. Callorhinchus milii cmi-miR-1-3
  6. Canis lupus familiaris (dog) cfa-miR-1
  7. Danio rerio microRNA miR-1
  8. Gallus gallus (chicken) gga-miR-1a-3p
  9. Gorilla gorilla gorilla ggo-miR-1 (MIR1)
  10. Gorilla gorilla ggo-miR-1
  11. Heligmosomoides polygyrus hpo-miR-1-3p
  12. Mus musculus Mus_musculus piRNA piR-mmu-34030223
  13. Oryzias latipes ola-miR-1-3p
  14. Ovis aries Pri-miR1.2
  15. Pan paniscus ppa-miR-1
  16. Pan troglodytes (chimpanzee) microRNA miR-1-2
  17. Python bivittatus (Burmese python) pbv-miR-1a-3p
  18. Scyliorhinus torazame Sto-Mir-1-P4_3p (mature (guide))
  19. Xenopus tropicalis xtr-miR-1a
Publications