Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-1 URS0000348947_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-miR-1: Cfa-mir-1 is a type of microRNA that is involved in ventricular remodeling in humans [PMC4490541]. However, in left ventricle cardiomyocytes from dogs, the expression of cfa-mir-1, along with cfa-mir-133 and cfa-miR-208, was not altered [PMC4490541]. In veterinary patients with congestive heart failure (CHF) after experimental ventricular pacing, various changes in miRNA concentrations have been observed. These include the downregulation of cfa-mir-1, cfa-miR-26a/b, cfa-miR-29a, cfa-miR-30a, cfa-mir-133a/b, cfa-miR-208a and cfa-miR-218 and the upregulation of cfa-miR-21 and cfa-mir146b [PMC5533140]. Cfa-mir-1 is also found in the heart and skeletal muscle of dogs along with other miRNAs such as CFA mir133a/b and CFA mir208 [PMC4989286]. In a study evaluating miRNA biomarkers for various tissues including liver (cfa mir122), heart/muscle (cfa mir1), muscle (cma mir133), pancreas (cma mi216) and brain (cma mi212), no significant changes were observed in the levels of non-liver enriched miRNAs including CFA mir 1 when compared to control dogs [PMC4989286]. Additionally, transient serum elevations of heart/muscle TE miRNAs such as CFA mir 1 were not correlated with microscopic findings and may be due to injury during animal handling [PMC4989286]. Histopathological analysis did not identify microscopic changes in heart or muscle tissues when compared to control dogs [PMC4989286]. In a qPCR validation study, cfa-mir-1 was selected as a biomarker candidate for heart/muscle toxicity [PMC4989286].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Ascaris suum (pig roundworm) asu-miR-1-3p
  2. Caenorhabditis brenneri cbn-miR-1
  3. Caenorhabditis briggsae cbr-miR-1
  4. Caenorhabditis elegans cel-miR-1-3p
  5. Callorhinchus milii cmi-miR-1-3
  6. Danio rerio microRNA miR-1
  7. Gallus gallus (chicken) gga-miR-1a-3p
  8. Gorilla gorilla gorilla ggo-miR-1 (MIR1)
  9. Gorilla gorilla ggo-miR-1
  10. Heligmosomoides polygyrus hpo-miR-1-3p
  11. Mus musculus Mus_musculus piRNA piR-mmu-34030223
  12. Oryzias latipes ola-miR-1-3p
  13. Ovis aries Pri-miR1.2
  14. Pan paniscus ppa-miR-1
  15. Pan troglodytes (chimpanzee) microRNA miR-1-2
  16. Python bivittatus (Burmese python) pbv-miR-1a-3p
  17. Scyliorhinus torazame Sto-Mir-1-P4_3p (mature (guide))
  18. Sus scrofa ssc-miR-1
  19. Xenopus tropicalis xtr-miR-1a
Publications