Equus caballus (horse) eca-miR-374b URS000033F45D_9796

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 14 other species
• 22 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AUAUAAUACAACCUGCUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Bos taurus (cattle) bta-miR-374b
2. Canis lupus familiaris (dog) cfa-miR-374b
3. Capra hircus (goat) chi-miR-374b-5p
4. Cricetulus griseus (Chinese hamster) cgr-miR-374-5p
5. Gorilla gorilla gorilla ggo-miR-374b (MIR374B)
6. Gorilla gorilla ggo-miR-374b
7. Homo sapiens hsa-miR-374b-5p
8. Macaca mulatta (Rhesus monkey) mml-miR-374b-5p
9. Mus musculus mmu-miR-374b-5p
10. Oryctolagus cuniculus ocu-miR-374b-5p
11. Pan troglodytes ptr-miR-374b
12. Pteropus alecto pal-miR-374b-5p
13. Rattus norvegicus rno-miR-374-5p
14. Sus scrofa (pig) ssc-miR-374b-5p

Publications Download

• FASTA
• JSON