Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-374b URS000033F45D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-374b: Bta-mir-374b is a microRNA that has been found to be upregulated in various studies. It was upregulated in response to Streptococcus agalactiae and Staphylococcus aureus infection in monocyte-derived macrophages and mammary gland tissue [PMC8568169]. In a different study, bta-mir-374b was one of three miRNAs that showed upregulation, while five miRNAs showed downregulation [PMC8568169]. It was also found to be differentially expressed with significant changes in two upregulated miRNAs and two downregulated miRNAs [PMC8568169]. In another study, bta-mir-374b showed significant upregulation in a group with clinical stages of JD infection [PMC8568169]. Additionally, bta-mir-374b was found to have low abundance levels compared to other groups [PMC5662615]. It has been shown that bta-mir-374b targets transcripts involved in signaling pathways regulating pluripotency of stem cells, mTOR signaling, and FoxO signaling [PMC9581129]. Furthermore, bta-mir-374b has been found to have altered expression in the seminal plasma of infertile men compared to fertile men [PMC9581129]. Bta-mir-374b is one of the bovine homologs of hsa-miR-374a-5p [PMC9459146]. In another study, bta-mir-374b was found to be upregulated in the LD of steers and confirmed by RT-qPCR [PMC8993808]. Finally, it was significantly enriched in HS-EVs compared to control-EVs along with other miRNAs [PMC7519046]. References: [PMC8568169] [PMC5662615] [PMC9581129] [PMC9459146] [PMC8993808] [PMC7519046]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAUAAUACAACCUGCUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Canis lupus familiaris (dog) cfa-miR-374b
  2. Capra hircus (goat) chi-miR-374b-5p
  3. Cricetulus griseus (Chinese hamster) cgr-miR-374-5p
  4. Equus caballus (horse) eca-miR-374b
  5. Gorilla gorilla gorilla ggo-miR-374b (MIR374B)
  6. Gorilla gorilla ggo-miR-374b
  7. Homo sapiens hsa-miR-374b-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-374b-5p
  9. Mus musculus mmu-miR-374b-5p
  10. Oryctolagus cuniculus ocu-miR-374b-5p
  11. Pan troglodytes ptr-miR-374b
  12. Pteropus alecto pal-miR-374b-5p
  13. Rattus norvegicus rno-miR-374-5p
  14. Sus scrofa (pig) ssc-miR-374b-5p
Publications