Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-374b URS000033F45D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-374b: Bta-mir-374b is a microRNA (miRNA) that has been identified as upregulated in bovine monocyte-derived macrophages and mammary gland tissue in response to infections by Streptococcus agalactiae and Staphylococcus aureus [PMC8568169]. This miRNA, along with bta-miR-2887, was consistently upregulated in sequencing experiments and showed significant differential expression in Group A, which represents clinical stages of Johne's disease (JD) infection [PMC8568169]. Bta-mir-374b was not found to be of low abundance in the C-EPL group when compared with the C-LTP and AI-LTP groups, which suggests a specific regulatory role during infection stages [PMC5662615]. Furthermore, bta-mir-374b is implicated in targeting transcripts that are significantly involved in key biological pathways such as signaling pathways regulating pluripotency of stem cells, mTOR signaling pathway, and FoxO signaling pathway [PMC9581129]. The statement regarding its expression in the spermatozoa of fertile men and seminal plasma of infertile men is incorrect and should be omitted as it does not pertain to bta-mir-374b. Bta-mir-374b has homologs such as hsa-miR-374a-5p that are considered promising for further research due to their regulatory potential [PMC9459146]. Additionally, bta-mir-374b was among miRNAs upregulated related to lipid metabolism pathways identified through differential expression analysis [PMC8993808], further highlighting its involvement across various biological processes.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAUAAUACAACCUGCUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Relationships

Molecular Relationships

Publications