Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-374b URS000033F45D_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAUAAUACAACCUGCUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus (cattle) bta-miR-374b
  2. Capra hircus (goat) chi-miR-374b-5p
  3. Cricetulus griseus (Chinese hamster) cgr-miR-374-5p
  4. Equus caballus (horse) eca-miR-374b
  5. Gorilla gorilla gorilla ggo-miR-374b (MIR374B)
  6. Gorilla gorilla ggo-miR-374b
  7. Homo sapiens hsa-miR-374b-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-374b-5p
  9. Mus musculus mmu-miR-374b-5p
  10. Oryctolagus cuniculus ocu-miR-374b-5p
  11. Pan troglodytes ptr-miR-374b
  12. Pteropus alecto pal-miR-374b-5p
  13. Rattus norvegicus rno-miR-374-5p
  14. Sus scrofa (pig) ssc-miR-374b-5p
Publications