Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-let-7b-5p URS0000324096_8030

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGGUUGUGUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 53 other species

  1. Alligator mississippiensis ami-let-7b-5p
  2. Anolis carolinensis Aca-Let-7-P2b2_5p (mature (guide))
  3. Bos taurus (cattle) bta-let-7b
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7b
  5. Canis lupus familiaris (dog) cfa-let-7b
  6. Capra hircus (goat) chi-let-7b-5p
  7. Cavia porcellus cpo-let-7b-5p
  8. Chrysemys picta bellii Cpi-Let-7-P2b2_5p (mature (guide))
  9. Chrysemys picta (Painted turtle) cpi-let-7b-5p
  10. Cricetulus griseus cgr-let-7b
  11. Cyprinus carpio (common carp) ccr-let-7b
  12. Danio rerio dre-let-7b
  13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7b-5p
  14. Daubentonia madagascariensis dma-let-7b
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2b2_5p (mature (guide))
  16. Gadus morhua Gmo-Let-7-P2b2a_5p (mature (guide))
  17. Gallus gallus (chicken) gga-let-7b
  18. Gekko japonicus Gja-Let-7-P2b2_5p (mature (guide))
  19. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7b
  20. Homo sapiens hsa-let-7b-5p
  21. Latimeria chalumnae (coelacanth) Lch-Let-7-P2b2_5p (mature (guide))
  22. Lepisosteus oculatus Loc-Let-7-P2b2_5p (mature (guide))
  23. Macaca mulatta mml-let-7b-5p
  24. Maylandia zebra mze-let-7b
  25. Microcaecilia unicolor Mun-Let-7-P2b2_5p (mature (guide))
  26. Microcebus murinus mmr-let-7b
  27. Monodelphis domestica (gray short-tailed opossum) mdo-let-7b
  28. Monopterus albus (swamp eel) Mal-Let-7-P2b2b_5p (mature (guide))
  29. Mus musculus mmu-let-7b-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-let-7b
  31. Ophiophagus hannah (king cobra) oha-let-7b-5p
  32. Oreochromis niloticus (Nile tilapia) oni-let-7b
  33. Ornithorhynchus anatinus (platypus) oan-let-7b-5p
  34. Oryctolagus cuniculus ocu-let-7b-5p
  35. Otolemur garnettii (small-eared galago) oga-let-7b
  36. Ovis aries (sheep) microRNA let-7b
  37. Pan paniscus ppa-let-7b
  38. Pan troglodytes ptr-let-7b
  39. Papio hamadryas pha-let-7b
  40. Paralichthys olivaceus (Japanese flounder) pol-let-7b-5p
  41. Pongo pygmaeus (Bornean orangutan) ppy-let-7b
  42. Pundamilia nyererei pny-let-7b
  43. Python bivittatus pbv-let-7b-5p
  44. Rattus norvegicus (Norway rat) rno-let-7b-5p
  45. Saimiri boliviensis boliviensis sbo-let-7b
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P2b2_5p (mature (guide))
  47. Sphenodon punctatus Spt-Let-7-P2b2_5p (mature (guide))
  48. Taeniopygia guttata (zebra finch) tgu-let-7b-5p
  49. Takifugu rubripes (torafugu) fru-let-7b
  50. Tetraodon nigroviridis tni-let-7b
  51. Tor tambroides let-7b
  52. Xenopus laevis Xla-Let-7-P2b2c_5p (mature (guide))
  53. Xenopus tropicalis Xtr-Let-7-P2b2_5p (mature (guide))
Publications