Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
mmu-let-7b: Mmu-let-7b is a miRNA that is dominantly expressed in Brucella-infected cells, along with other miRNAs such as mmu-miR-21, mmu-let-7c, and mmu-miR-146b [PMC3421232]. The expression of mmu-let-7b was analyzed using Applied Biosystems TaqMan® miRNA assays [PMC4077261]. The selection of miRNAs for analysis was based on their potential role in lung pathology and their expression levels [PMC3030602]. Mmu-let-7b was found to be downregulated in fetal thymocytes post TCDD exposure and has a highly complementary sequence with FasL 3′UTR, suggesting its involvement in FasL expression [PMC3443208]. Mmu-let-7b has also been shown to be downregulated by TCDD in fetal thymi and is associated with cancer development [PMC3443208]. In response to obesity and weight reduction following LFD feeding, mmu-let-7b was found to be dysregulated along with other members of the Let-7 family [PMC4571067]. Mmu-miR 103 and 107 have similar mature sequences to mmu-miR 103: AGCAGCAUUGUACAGGGCUAUGA and mmu-miR 107: AGCAGCAUUGUACAGGGCUAUCA respectively [PMC4571067]. Let71 is also expressed significantly only in kidney, lung, ovary [PMC1635289]. In granulosa cells of mouse MII oocytes, mmu-let-7b, mmu-let-7c, mmu-miR-27a, and mmu-miR-322 were significantly downregulated compared to MI oocytes [PMC4069098].
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset