Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-26b-5p URS0000316FA5_9606

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUUCAGGAUAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus microRNA miR-26b
  2. Gorilla gorilla gorilla ggo-miR-26b (MIR26B)
  3. Gorilla gorilla (western gorilla) ggo-miR-26b
  4. Macaca mulatta (Rhesus monkey) mml-miR-26b-5p
  5. Mus musculus (house mouse) mmu-miR-26b-5p
  6. Ovis aries (sheep) oar-miR-26b
  7. Pan troglodytes ptr-miR-26b
  8. Pongo pygmaeus ppy-miR-26b
  9. Rattus norvegicus rno-miR-26b-5p
  10. Tursiops truncatus miR-26b
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2112542
Publications