v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2112542 URS0000316FA5_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCAAGUAAUUCAGGAUAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus microRNA miR-26b
  2. Gorilla gorilla gorilla ggo-miR-26b (MIR26B)
  3. Gorilla gorilla (western gorilla) ggo-miR-26b
  4. Homo sapiens (human) hsa-miR-26b-5p
  5. Macaca mulatta (Rhesus monkey) mml-miR-26b-5p
  6. Mus musculus (house mouse) mmu-miR-26b-5p
  7. Ovis aries (sheep) oar-miR-26b
  8. Pan troglodytes ptr-miR-26b
  9. Pongo pygmaeus ppy-miR-26b
  10. Rattus norvegicus rno-miR-26b-5p
  11. Tursiops truncatus miR-26b