Macaca mulatta (Rhesus monkey) mml-miR-26b-5p URS0000316FA5_9544

• 21 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 11 other species
• 1935 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUCAAGUAAUUCAGGAUAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Bos taurus microRNA miR-26b
2. Gorilla gorilla gorilla ggo-miR-26b (MIR26B)
3. Gorilla gorilla (western gorilla) ggo-miR-26b
4. Homo sapiens (human) hsa-miR-26b-5p
5. Mus musculus (house mouse) mmu-miR-26b-5p
6. Ovis aries (sheep) oar-miR-26b
7. Pan troglodytes ptr-miR-26b
8. Pongo pygmaeus ppy-miR-26b
9. Rattus norvegicus rno-miR-26b-5p
10. Tursiops truncatus miR-26b
11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2112542

Publications Download

• FASTA
• JSON