Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-130b URS00002C0FCB_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-130b: Cfa-mir-130b is a microRNA that has been found to be upregulated in dogs with various heart diseases, including MMVD, PDA, and PS [PMC8542680]. It has been shown to be more accurate than NT-proBNP in discriminating dogs with heart diseases from healthy dogs [PMC8542680]. Cfa-mir-130b is commonly upregulated in different heart diseases, suggesting that it may be related to common physiological or pathological changes induced by these diseases [PMC8542680]. However, the specific target genes and pathways of cfa-mir-130b in heart diseases have not been identified and validated yet [PMC8542680]. In MMVD stage B, cfa-mir-130b showed a strong positive correlation with HR, NT-proBNP, and LA/Ao ratio [PMC8542680]. It also showed higher sensitivity and specificity than NT-proBNP in MMVD stage B, PDA, and PS groups [PMC8542680]. However, cfa-mir-130b was not found to be a reliable biomarker for the entire MMVD group or for advanced stages of the disease (stage C and D) [PMC8542680]. In addition to its role as a biomarker for heart diseases in dogs, cfa-mir-130b has also been implicated in the pathogenesis and inflammatory responses of canine echinococcosis [PMC7480022]. Overall, cfa-mir-130b shows promise as a common biomarker for various heart diseases in dogs but further research is needed to fully understand its target genes and pathways as well as its role in different stages of disease progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGAUGAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-130b
  2. Callithrix jacchus cja-miR-130b
  3. Capra hircus (goat) chi-miR-130b-3p
  4. Cavia porcellus cpo-miR-130b-3p
  5. Cricetulus griseus cgr-miR-130b-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130b-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P4a_3p (mature (guide))
  8. Equus caballus eca-miR-130b
  9. Homo sapiens hsa-miR-130b-3p
  10. Macaca mulatta (Rhesus monkey) mml-miR-130b-3p
  11. Mus musculus (house mouse) mmu-miR-130b-3p
  12. Oryctolagus cuniculus ocu-miR-130b-3p
  13. Pan troglodytes ptr-miR-130b
  14. Pongo pygmaeus ppy-miR-130b
  15. Rattus norvegicus (Norway rat) rno-miR-130b-3p
  16. Sus scrofa ssc-miR-130b-3p
  17. Xenopus laevis (African clawed frog) xla-miR-130b-3p
  18. Xenopus tropicalis (tropical clawed frog) xtr-miR-130b
Publications