Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-130b URS00002C0FCB_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGAUGAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-130b
  2. Callithrix jacchus cja-miR-130b
  3. Canis lupus familiaris (dog) cfa-miR-130b
  4. Capra hircus (goat) chi-miR-130b-3p
  5. Cavia porcellus cpo-miR-130b-3p
  6. Cricetulus griseus cgr-miR-130b-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-130b-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P4a_3p (mature (guide))
  9. Equus caballus eca-miR-130b
  10. Homo sapiens hsa-miR-130b-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-130b-3p
  12. Mus musculus (house mouse) mmu-miR-130b-3p
  13. Oryctolagus cuniculus ocu-miR-130b-3p
  14. Pongo pygmaeus ppy-miR-130b
  15. Rattus norvegicus (Norway rat) rno-miR-130b-3p
  16. Sus scrofa ssc-miR-130b-3p
  17. Xenopus laevis (African clawed frog) xla-miR-130b-3p
  18. Xenopus tropicalis (tropical clawed frog) xtr-miR-130b
Publications