Arabidopsis lyrata (lyrate rockcress) aly-miR169d-5p URS0000292D82_59689

• 21 nucleotides
• 2 databases (ENA, miRBase)
• Found in 10 other species
• 1 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAGCCAAGGAUGACUUGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Arabidopsis thaliana (thale cress) ath-miR169g-5p
2. Corchorus capsularis sRNA CCACVL1_17299
3. Corchorus olitorius aly-miR169d-
4. Glycine max gma-miR169p
5. Linum usitatissimum lus-miR169i
6. Manihot esculenta (cassava) mes-miR169h
7. Pachycladon fastigiatum Pfa-miR169g
8. Populus trichocarpa (black cottonwood) ptc-miR169n-5p
9. Ricinus communis rco-miR169c
10. Theobroma cacao tcc-miR169m

Publications Download

• FASTA
• JSON