Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Corchorus capsularis (jute) sRNA CCACVL1_17299 URS0000292D82_210143

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCCAAGGAUGACUUGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR169d-5p
  2. Arabidopsis thaliana (thale cress) ath-miR169g-5p
  3. Corchorus olitorius aly-miR169d-
  4. Glycine max gma-miR169p
  5. Linum usitatissimum lus-miR169i
  6. Manihot esculenta (cassava) mes-miR169h
  7. Pachycladon fastigiatum Pfa-miR169g
  8. Populus trichocarpa (black cottonwood) ptc-miR169n-5p
  9. Ricinus communis rco-miR169c
  10. Theobroma cacao tcc-miR169m