Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pieris macdunnoughi tRNA secondary structure diagram

Pieris macdunnoughi tRNA URS0000285C66_345717

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACGAGGUGGCCGAGAGGUUAAGGCGUUGGACUGCUAAUCCAAUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 137 other species

  1. Aedes aegypti (Yellow fever mosquito) tRNA AAEL016539
  2. Aedes albopictus tRNA tRNA-Ser
  3. Amyelois transitella tRNA-Ser
  4. Anastrepha ludens (Mexican fruit fly) transfer RNA serine (anticodon GCU)
  5. Anastrepha obliqua (WestIndian fruit fly) transfer RNA serine (anticodon GCU)
  6. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000005567.1
  7. Anopheles albimanus tRNA tRNA-Ser
  8. Anopheles arabiensis tRNA
  9. Anopheles atroparvus tRNA
  10. Anopheles christyi tRNA
  11. Anopheles coluzzii tRNA tRNA-Ser
  12. Anopheles culicifacies tRNA tRNA-Ser
  13. Anopheles darlingi (American malaria mosquito) tRNA Serine
  14. Anopheles dirus tRNA tRNA-Ser
  15. Anopheles epiroticus (Mosquito) tRNA tRNA-Ser
  16. Anopheles farauti (Mosquito) tRNA tRNA-Ser
  17. Anopheles funestus tRNA-Ser for anticodon GCU
  18. Anopheles gambiae tRNA tRNA-Ser
  19. Anopheles gambiae str. PEST tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  20. Anopheles maculatus tRNA tRNA-Ser
  21. Anopheles melas (Mosquito) tRNA tRNA-Ser
  22. Anopheles merus (Mosquito) tRNA tRNA-Ser
  23. Anopheles minimus tRNA
  24. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Ser
  25. Anopheles sinensis tRNA tRNA-Ser
  26. Anopheles stephensi tRNA tRNA-Ser
  27. Apis cerana cerana tRNA
  28. Apis florea (Dwarf honeybee) tRNA-Ser
  29. Apis mellifera tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  30. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005005149.1
  31. Bactrocera dorsalis tRNA-Ser
  32. Bactrocera latifrons (Solanum fruit fly) tRNA-Ser
  33. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA serine (anticodon GCU)
  34. Bactrocera tryoni tRNA-Ser
  35. Bombus affinis (Rusty patched bumble bee) transfer RNA serine (anticodon GCU)
  36. Bombus huntii (Hunt's bumblebee) transfer RNA serine (anticodon GCU)
  37. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119973
  38. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Ser
  39. Bombus vosnesenskii tRNA
  40. Bombyx mandarina tRNA-Ser
  41. Bombyx mori tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  42. Brenthis ino (lesser marbled fritillary) tRNA
  43. Cephus cinctus (wheat stem sawfly) tRNA
  44. Ceratitis capitata tRNA-Ser
  45. Chrysodeixis includens tRNA
  46. Culex pipiens pallens (Northern house mosquito) transfer RNA serine (anticodon GCU)
  47. Culex quinquefasciatus tRNA tRNA-Ser
  48. Danaus chrysippus (African queen) tRNA
  49. Danaus plexippus plexippus tRNA
  50. Diatraea saccharalis (sugarcane borer) tRNA
  51. Dinoponera quadriceps (south american ant) tRNA
  52. Drosophila albomicans (Fruit fly) transfer RNA serine (anticodon GCU)
  53. Drosophila ananassae tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  54. Drosophila arizonae (Fruit fly) tRNA-Ser
  55. Drosophila biarmipes (Fruit fly) transfer RNA serine (anticodon GCU)
  56. Drosophila bipectinata (Fruit fly) tRNA-Ser
  57. Drosophila busckii (Fruit fly) tRNA-Ser
  58. Drosophila elegans (Fruit fly) tRNA-Ser
  59. Drosophila erecta tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  60. Drosophila eugracilis (Fruit fly) tRNA-Ser
  61. Drosophila ficusphila (Fruit fly) tRNA-Ser
  62. Drosophila grimshawi tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  63. Drosophila guanche (Fruit fly) tRNA-Ser
  64. Drosophila gunungcola (Fruit fly) transfer RNA serine (anticodon GCU)
  65. Drosophila hydei (Fruit fly) tRNA-Ser
  66. Drosophila innubila (Fruit fly) tRNA-Ser
  67. Drosophila kikkawai (Fruit fly) tRNA-Ser
  68. Drosophila mauritiana (Fruit fly) tRNA-Ser
  69. Drosophila melanogaster transfer RNA:Serine-GCT 2-4 (Dmel_CR31162, Dmel_CR31165, Dmel_CR31166, Dmel_CR31396, Dmel_CR31476)
  70. Drosophila miranda (Fruit fly) tRNA-Ser
  71. Drosophila mojavensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  72. Drosophila navojoa (Fruit fly) tRNA-Ser
  73. Drosophila obscura (Fruit fly) tRNA-Ser
  74. Drosophila persimilis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  75. Drosophila pseudoobscura (Fruit fly) tRNA-Ser
  76. Drosophila pseudoobscura pseudoobscura tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  77. Drosophila rhopaloa (Fruit fly) tRNA-Ser
  78. Drosophila santomea (Fruit fly) tRNA-Ser
  79. Drosophila sechellia tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  80. Drosophila simulans tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  81. Drosophila subobscura (Fruit fly) tRNA-Ser
  82. Drosophila subpulchrella (Fruit fly) tRNA-Ser
  83. Drosophila suzukii (Fruit fly) tRNA-Ser
  84. Drosophila takahashii (Fruit fly) tRNA-Ser
  85. Drosophila teissieri (Fruit fly) tRNA-Ser
  86. Drosophila virilis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  87. Drosophila willistoni tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  88. Drosophila yakuba tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  89. Dufourea novaeangliae tRNA-Ser
  90. Frieseomelitta varia tRNA
  91. Galleria mellonella tRNA-Ser
  92. Habropoda laboriosa tRNA-Ser
  93. Harpegnathos saltator (Indian jumping ant) tRNA-Ser
  94. Heliconius melpomene (Postman butterfly) tRNA HMEL004587
  95. Helicoverpa armigera (Cotton bollworm) transfer RNA serine (anticodon GCU)
  96. Helicoverpa zea (Corn earworm) tRNA-Ser
  97. Heliothis virescens (tobacco budworm) tRNA
  98. Heterotrigona itama tRNA
  99. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA serine (anticodon GCU)
  100. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA serine (anticodon GCU)
  101. Leguminivora glycinivorella (Soybean pod borer) tRNA-Ser
  102. Linepithema humile (Argentine ant) tRNA-Ser
  103. Malaya genurostris (Mosquitos) transfer RNA serine (anticodon GCU)
  104. Manduca sexta tRNA-Ser
  105. Megachile rotundata tRNA-Ser
  106. Melipona bicolor tRNA
  107. Melipona quadrifasciata tRNA
  108. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023365.1
  109. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Ser
  110. Neodiprion pinetum (White pine sawfly) tRNA-Ser
  111. Operophtera brumata tRNA
  112. Papilio machaon tRNA
  113. Papilio xuthus tRNA
  114. Pararge aegeria aegeria tRNA
  115. Pararge aegeria tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  116. Arctia plantaginis Parasemia plantaginis tRNA
  117. Parnassius apollo (apollo) tRNA
  118. Pectinophora gossypiella transfer RNA serine (anticodon GCU)
  119. Plodia interpunctella (Indianmeal moth) transfer RNA serine (anticodon GCU)
  120. Plutella xylostella (diamondback moth) tRNA
  121. Polistes canadensis tRNA-Ser
  122. Polistes dominula (European paper wasp) tRNA-Ser
  123. Polistes fuscatus tRNA-Ser
  124. Pollicipes pollicipes tRNA-Ser
  125. Rhagoletis pomonella (Apple magot fly) tRNA-Ser
  126. Scaptodrosophila lebanonensis tRNA
  127. Schistocerca americana tRNA-Ser
  128. Schistocerca piceifrons (Central American locust) tRNA-Ser
  129. Spodoptera exigua (beet armyworm) tRNA
  130. Spodoptera frugiperda tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 9)
  131. Spodoptera littoralis tRNA
  132. Spodoptera litura tRNA
  133. Topomyia yanbarensis (Mosquitos) transfer RNA serine (anticodon GCU)
  134. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA serine (anticodon GCU)
  135. Trichoplusia ni (cabbage looper) tRNA
  136. Uranotaenia lowii (Mosquitos) transfer RNA serine (anticodon GCU)
  137. Vespula germanica tRNA
  138. Vespula pensylvanica (western yellowjacket) tRNA
  139. Vespula vulgaris tRNA
  140. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA serine (anticodon GCU)
  141. Zeugodacus cucurbitae (Melon fly) transfer RNA serine (anticodon GCU)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...