Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dufourea novaeangliae (Bee) tRNA-Ser secondary structure diagram

Dufourea novaeangliae (Bee) tRNA-Ser URS0000285C66_178035

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACGAGGUGGCCGAGAGGUUAAGGCGUUGGACUGCUAAUCCAAUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 83 other species

  1. Aedes aegypti tRNA AAEL016539
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Ser
  3. Amyelois transitella (Naval orange worm) tRNA-Ser
  4. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000005567.1
  5. Anopheles albimanus (Mosquito) tRNA tRNA-Ser
  6. Anopheles arabiensis (Southern African malaria mosquito) tRNA
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA
  9. Anopheles coluzzii tRNA tRNA-Ser
  10. Anopheles culicifacies (Mosquito) tRNA tRNA-Ser
  11. Anopheles darlingi (American malaria mosquito) tRNA Serine
  12. Anopheles dirus (Mosquito) tRNA tRNA-Ser
  13. Anopheles epiroticus tRNA tRNA-Ser
  14. Anopheles farauti (Mosquito) tRNA tRNA-Ser
  15. Anopheles funestus tRNA-Ser for anticodon GCU
  16. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Ser
  17. Anopheles gambiae str. PEST tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  18. Anopheles maculatus (Mosquito) tRNA tRNA-Ser
  19. Anopheles melas tRNA tRNA-Ser
  20. Anopheles merus (Mosquito) tRNA tRNA-Ser
  21. Anopheles minimus tRNA
  22. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Ser
  23. Anopheles sinensis (Mosquito) tRNA tRNA-Ser
  24. Anopheles stephensi tRNA tRNA-Ser
  25. Apis florea tRNA-Ser
  26. Apis mellifera tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  27. Athalia rosae misc RNA ENSAEAG00005005149.1
  28. Bactrocera dorsalis (Oriental fruit fly) tRNA-Ser
  29. Bactrocera latifrons (Solanum fruit fly) tRNA-Ser
  30. Bactrocera tryoni tRNA-Ser
  31. Bombus huntii (Hunt's bumblebee) transfer RNA serine (anticodon GCU)
  32. Bombus terrestris (Buff-tailed bumblebee) tRNA LOC110119973
  33. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Ser
  34. Bombyx mandarina (Wild silkworm) tRNA-Ser
  35. Bombyx mori tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  36. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ser
  37. Culex quinquefasciatus tRNA tRNA-Ser
  38. Danaus plexippus plexippus tRNA
  39. Drosophila ananassae tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  40. Drosophila busckii tRNA
  41. Drosophila erecta tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  42. Drosophila ficusphila tRNA
  43. Drosophila grimshawi tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  44. Drosophila guanche tRNA.Ser
  45. Drosophila gunungcola tRNA-OTHER
  46. Drosophila melanogaster (fruit fly) transfer RNA:Serine-GCT 2-4 (Dmel_CR31162, Dmel_CR31165, Dmel_CR31166, Dmel_CR31396, Dmel_CR31476)
  47. Drosophila mojavensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  48. Drosophila persimilis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  49. Drosophila pseudoobscura pseudoobscura tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  50. Drosophila sechellia tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  51. Drosophila simulans tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  52. Drosophila virilis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  53. Drosophila willistoni tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  54. Drosophila yakuba tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  55. Frieseomelitta varia tRNA-Ser
  56. Galleria mellonella (Greater wax moth) tRNA-Ser
  57. Habropoda laboriosa tRNA-Ser
  58. Harpegnathos saltator (Indian jumping ant) tRNA-Ser
  59. Heliconius melpomene tRNA HMEL004587
  60. Helicoverpa armigera transfer RNA serine (anticodon GCU)
  61. Helicoverpa zea (Corn earworm) tRNA-Ser
  62. Leguminivora glycinivorella tRNA-Ser
  63. Linepithema humile (Argentine ant) tRNA-Ser
  64. Manduca sexta (Tobacco hornworm) tRNA-Ser
  65. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Ser
  66. Melipona bicolor tRNA-Ser
  67. Melipona quadrifasciata tRNA
  68. Melitaea cinxia misc RNA ENSMCXG00005023365.1
  69. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Ser
  70. Neodiprion pinetum (White pine sawfly) tRNA-Ser
  71. Operophtera brumata tRNA
  72. Papilio machaon tRNA
  73. Papilio xuthus tRNA
  74. Pararge aegeria tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  75. Pectinophora gossypiella (Pink bollworm) transfer RNA serine (anticodon GCU)
  76. Polistes canadensis tRNA-Ser
  77. Polistes dominula tRNA-Ser
  78. Polistes fuscatus tRNA-Ser
  79. Pollicipes pollicipes tRNA-Ser
  80. Rhagoletis pomonella (Apple magot fly) tRNA-Ser
  81. Schistocerca americana (American grasshopper) tRNA-Ser
  82. Schistocerca piceifrons (Central American locust) tRNA-Ser
  83. Spodoptera frugiperda tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 9)
2D structure Publications