Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cephus cinctus (wheat stem sawfly) tRNA secondary structure diagram

Cephus cinctus (wheat stem sawfly) tRNA URS0000285C66_211228

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACGAGGUGGCCGAGAGGUUAAGGCGUUGGACUGCUAAUCCAAUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 147 other species

  1. Aedes aegypti tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 5)
  2. Aedes albopictus tRNA tRNA-Ser
  3. Amyelois transitella (Moths) transfer RNA serine (anticodon GCU)
  4. Anastrepha ludens (Mexican fruit fly) transfer RNA serine (anticodon GCU)
  5. Anastrepha obliqua (WestIndian fruit fly) transfer RNA serine (anticodon GCU)
  6. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000005567.1
  7. Anopheles albimanus (Mosquitos) tRNA-Ser
  8. Anopheles arabiensis tRNA
  9. Anopheles atroparvus tRNA
  10. Anopheles christyi tRNA
  11. Anopheles coluzzii tRNA tRNA-Ser
  12. Anopheles culicifacies (Mosquito) tRNA tRNA-Ser
  13. Anopheles darlingi (American malaria mosquito) tRNA Serine
  14. Anopheles dirus (Mosquito) tRNA tRNA-Ser
  15. Anopheles epiroticus tRNA tRNA-Ser
  16. Anopheles farauti tRNA tRNA-Ser
  17. Anopheles funestus tRNA-Ser for anticodon GCU
  18. Anopheles gambiae tRNA tRNA-Ser
  19. Anopheles gambiae str. PEST tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  20. Anopheles maculatus (Mosquito) tRNA tRNA-Ser
  21. Anopheles melas tRNA tRNA-Ser
  22. Anopheles merus tRNA tRNA-Ser
  23. Anopheles minimus tRNA
  24. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Ser
  25. Anopheles sinensis (Mosquito) tRNA tRNA-Ser
  26. Anopheles stephensi tRNA tRNA-Ser
  27. Apis cerana cerana tRNA
  28. Apis florea (Dwarf honeybee) tRNA-Ser
  29. Apis mellifera tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  30. Athalia rosae misc RNA ENSAEAG00005005149.1
  31. Bactrocera dorsalis transfer RNA serine (anticodon GCU)
  32. Bactrocera latifrons (Solanum fruit fly) tRNA-Ser
  33. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA serine (anticodon GCU)
  34. Bactrocera oleae (Olive fruit fly) tRNA-Ser
  35. Bactrocera tryoni tRNA-Ser
  36. Bombus affinis (Rusty patched bumble bee) transfer RNA serine (anticodon GCU)
  37. Bombus huntii (Hunt's bumblebee) transfer RNA serine (anticodon GCU)
  38. Bombus impatiens (Common eastern bumblebee) tRNA-Ser
  39. Bombus terrestris (Bombus terrestris) misc RNA ENSBTSG00005021183.1
  40. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Ser
  41. Bombus vosnesenskii tRNA
  42. Bombyx mandarina tRNA-Ser
  43. Bombyx mori tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  44. Brenthis ino (lesser marbled fritillary) tRNA
  45. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ser
  46. Chrysodeixis includens tRNA
  47. Culex pipiens pallens (Northern house mosquito) transfer RNA serine (anticodon GCU)
  48. Culex quinquefasciatus tRNA
  49. Cydia pomonella (The codling moth) transfer RNA serine (anticodon GCU)
  50. Danaus chrysippus (African queen) tRNA
  51. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018815.1
  52. Danaus plexippus plexippus (Monarch butterfly) tRNA-Ser
  53. Diatraea saccharalis (sugarcane borer) tRNA
  54. Dinoponera quadriceps (south american ant) tRNA
  55. Drosophila albomicans (Fruit fly) transfer RNA serine (anticodon GCU)
  56. Drosophila ananassae tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  57. Drosophila arizonae (Fruit fly) tRNA-Ser
  58. Drosophila biarmipes (Fruit fly) transfer RNA serine (anticodon GCU)
  59. Drosophila bipectinata (Pomace flies) transfer RNA serine (anticodon GCU)
  60. Drosophila busckii (Fruit fly) tRNA-Ser
  61. Drosophila elegans (Pomace flies) tRNA-Ser
  62. Drosophila erecta tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  63. Drosophila eugracilis (Fruit fly) tRNA-Ser
  64. Drosophila ficusphila (Fruit fly) tRNA-Ser
  65. Drosophila grimshawi tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  66. Drosophila guanche (Fruit fly) tRNA-Ser
  67. Drosophila gunungcola (Fruit fly) transfer RNA serine (anticodon GCU)
  68. Drosophila hydei (Fruit fly) tRNA-Ser
  69. Drosophila innubila (Fruit fly) tRNA-Ser
  70. Drosophila kikkawai (Pomace flies) transfer RNA serine (anticodon GCU)
  71. Drosophila mauritiana (Fruit fly) tRNA-Ser
  72. Drosophila melanogaster transfer RNA:Serine-GCT 2-4 (Dmel_CR31162, Dmel_CR31165, Dmel_CR31166, Dmel_CR31396, Dmel_CR31476)
  73. Drosophila miranda (Fruit fly) tRNA-Ser
  74. Drosophila mojavensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  75. Drosophila montana (Pomace flies) transfer RNA serine (anticodon GCU)
  76. Drosophila nasuta (Pomace flies) transfer RNA serine (anticodon GCU)
  77. Drosophila navojoa (Fruit fly) tRNA-Ser
  78. Drosophila novamexicana (Pomace flies) tRNA-Ser
  79. Drosophila obscura (Fruit fly) tRNA-Ser
  80. Drosophila persimilis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  81. Drosophila pseudoobscura (Fruit fly) tRNA-Ser
  82. Drosophila pseudoobscura pseudoobscura tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  83. Drosophila rhopaloa (Fruit fly) tRNA-Ser
  84. Drosophila santomea (Fruit fly) tRNA-Ser
  85. Drosophila sechellia tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  86. Drosophila serrata (Pomace flies) tRNA-Ser
  87. Drosophila simulans tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  88. Drosophila subobscura (Fruit fly) tRNA-Ser
  89. Drosophila subpulchrella (Fruit fly) tRNA-Ser
  90. Drosophila sulfurigaster albostrigata (Flies) transfer RNA serine (anticodon GCU)
  91. Drosophila suzukii (Pomace flies) transfer RNA serine (anticodon GCU)
  92. Drosophila takahashii (Pomace flies) transfer RNA serine (anticodon GCU)
  93. Drosophila teissieri (Fruit fly) tRNA-Ser
  94. Drosophila tropicalis (Pomace flies) transfer RNA serine (anticodon GCU)
  95. Drosophila virilis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  96. Drosophila willistoni tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  97. Drosophila yakuba tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  98. Dufourea novaeangliae (Bee) tRNA-Ser
  99. Frieseomelitta varia tRNA
  100. Galleria mellonella (greater wax moth) tRNA
  101. Habropoda laboriosa tRNA-Ser
  102. Harpegnathos saltator tRNA-Ser
  103. Heliconius melpomene tRNA HMEL004587
  104. Helicoverpa armigera (Cotton bollworm) transfer RNA serine (anticodon GCU)
  105. Helicoverpa zea tRNA-Ser
  106. Heliothis virescens (tobacco budworm) tRNA
  107. Heterotrigona itama tRNA
  108. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA serine (anticodon GCU)
  109. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA serine (anticodon GCU)
  110. Leguminivora glycinivorella tRNA-Ser
  111. Linepithema humile (Argentine ant) transfer RNA serine (anticodon GCU)
  112. Malaya genurostris (Mosquitos) transfer RNA serine (anticodon GCU)
  113. Manduca sexta tRNA-Ser
  114. Megachile rotundata tRNA-Ser
  115. Melipona bicolor tRNA
  116. Melipona quadrifasciata tRNA
  117. Melitaea cinxia misc RNA ENSMCXG00005023365.1
  118. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Ser
  119. Neodiprion pinetum tRNA-Ser
  120. Operophtera brumata tRNA
  121. Papilio machaon tRNA
  122. Papilio xuthus tRNA
  123. Pararge aegeria aegeria tRNA
  124. Pararge aegeria tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1)
  125. Arctia plantaginis Parasemia plantaginis tRNA
  126. Parnassius apollo (apollo) tRNA
  127. Pectinophora gossypiella transfer RNA serine (anticodon GCU)
  128. Phthorimaea operculella tRNA-Ser
  129. Pieris macdunnoughi tRNA
  130. Plodia interpunctella (Indianmeal moth) transfer RNA serine (anticodon GCU)
  131. Plutella xylostella (diamondback moth) tRNA
  132. Polistes canadensis (Red paper wasp) tRNA-Ser
  133. Polistes dominula tRNA-Ser
  134. Polistes fuscatus (Common paper wasp) tRNA-Ser
  135. Pollicipes pollicipes tRNA-Ser
  136. Rhagoletis pomonella (Apple magot fly) tRNA-Ser
  137. Scaptodrosophila lebanonensis tRNA
  138. Schistocerca americana tRNA-Ser
  139. Schistocerca piceifrons (Central American locust) tRNA-Ser
  140. Spodoptera exigua (beet armyworm) tRNA
  141. Spodoptera frugiperda tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 9)
  142. Spodoptera littoralis tRNA
  143. Spodoptera litura tRNA
  144. Topomyia yanbarensis (Mosquitos) transfer RNA serine (anticodon GCU)
  145. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA serine (anticodon GCU)
  146. Trichoplusia ni (cabbage looper) tRNA
  147. Uranotaenia lowii (Mosquitos) transfer RNA serine (anticodon GCU)
  148. Vespa mandarinia (Asian giant hornet) tRNA-Ser
  149. Vespula germanica tRNA
  150. Vespula pensylvanica (western yellowjacket) tRNA
  151. Vespula vulgaris tRNA
  152. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA serine (anticodon GCU)
  153. Zeugodacus cucurbitae (Melon fly) transfer RNA serine (anticodon GCU)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications