Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-23b precursor URS0000283D0A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-23b: Hsa-mir-23b is a microRNA that has been found to be present in the saliva of patients diagnosed with intraductal papillary mucinous neoplasm (IPMN) and could potentially be used in the management of IPMN [PMC4486170]. In a study, 16 miRNAs were found to be significantly up-regulated, including hsa-miR-32, hsa-miR-19a, hsa-miR-18b, hsa-miR-96, hsa-miR-183, hsa-miR-130b, hsa-miR-182, hsa-miR-18a, hsa-miR-375, hsa-miR-106a, hsa-miR-106b, hsa-mir-425, hsa-mir17a and 25 [PMC5788610]. Additionally 13 miRNAs were significantly down-regulated including has miRNA 100 and has miRNA 23a [PMC5788610]. HSA mir23b is also down-regulated in IPMN patients [PMC5788610]. These findings suggest that the dysregulation of these miRNAs may play a role in the development and progression of IPMN. Further research is needed to fully understand the functional significance of these dysregulated miRNAs and their potential as diagnostic or prognostic markers for IPMN. The study provides valuable insights into the potential use of saliva-based biomarkers for decision making in IPMN management. The identification of specific dysregulated miRNAs such as has mir23b could potentially lead to improved diagnostic and therapeutic strategies for patients with IPMN [PMC4486170] [PMC5788610].

MIR23B: MIR23B is a microRNA that plays a role in controlling inflammatory- and ROS-mediated events in an animal model of neuropathic pain [PMC3542604]. It has been found to target a mitochondrial tumor suppressor called proline oxidase (POX), and over-expression of MIR23B leads to down-regulation of POX in renal cancer [PMC5814174]. In a study using LNA probes, MIR23B and Mir133b were found to be robustly expressed in various facial structures, although there was high overall background staining [PMC4943961]. Furthermore, when comparing patients with subacute cutaneous lupus erythematosus (SCLE) versus discoid lupus erythematosus (DLE), the SCLE group exhibited significantly lower levels of miR-1246, miR-146, and MIR23B [PMC7012207]. These findings suggest that MIR23B has implications in neuropathic pain, renal cancer, facial structures, and different subtypes of lupus erythematosus.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications