Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000022329.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000022329.1) URS0000283D0A_336983

97 nucleotides
1 database (Ensembl)
Found in 12 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Cercocebus atys microRNA 23b (ENSCATG00000019655.1)
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 23b (ENSGGOG00000031578.2)
Homo sapiens (human) microRNA hsa-mir-23b precursor
Macaca mulatta (Rhesus monkey) microRNA mml-mir-23b precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 23b (ENSMNEG00000001211.1)
Nomascus leucogenys microRNA 23b (ENSNLEG00000023381.2)
Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-23b precursor
Pan troglodytes microRNA ptr-mir-23b precursor
Pongo abelii (Sumatran orangutan) microRNA 23b (ENSPPYG00000021972.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-23b precursor
Rhinopithecus bieti microRNA 23b (ENSRBIG00000005797.1)
Rhinopithecus roxellana microRNA 23b (ENSRROG00000022669.1)