Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-134-5p URS0000272A92_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGACUGGUUGACCAGAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-134
  2. Canis lupus familiaris (dog) cfa-miR-134
  3. Capra hircus (goat) chi-miR-134
  4. Cavia porcellus cpo-miR-134-5p
  5. Cricetulus griseus cgr-miR-134
  6. Equus caballus eca-miR-134
  7. Homo sapiens hsa-miR-134-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-134-5p
  9. Mus musculus (house mouse) mmu-miR-134-5p
  10. Pan troglodytes ptr-miR-134
Publications