v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-134-5p URS0000272A92_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-134: Hsa-mir-134 is a microRNA that has been studied in relation to its potential usefulness in determining plasma levels in patients with psychogenic non-epileptic seizures (PNES) [PMC5383023]. However, further research is needed to fully explore its clinical application in this specific context [PMC5383023]. In a study using MKN-45 cells, it was found that transfection with hsa-mir-134 mimic or inhibitor did not have an impact on the invasion capacity of tumor cells [PMC3854519].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUGACUGGUUGACCAGAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-134
  2. Canis lupus familiaris (dog) cfa-miR-134
  3. Capra hircus (goat) chi-miR-134
  4. Cavia porcellus cpo-miR-134-5p
  5. Cricetulus griseus cgr-miR-134
  6. Equus caballus eca-miR-134
  7. Macaca mulatta (Rhesus monkey) mml-miR-134-5p
  8. Mus musculus (house mouse) mmu-miR-134-5p
  9. Pan troglodytes ptr-miR-134
  10. Rattus norvegicus rno-miR-134-5p
 Publications