Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-134-5p URS0000272A92_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-134: Mmu-mir-134 is a microRNA that has been found to increase its expression significantly at different times post-infection [PMC9861972]. It has also been reported to be highly elevated in infected liver cells [PMC9861972]. Mmu-mir-134 has been selected as a candidate for functional verification [PMC9120625]. It has been shown to inhibit genes related to pluripotency, such as Nanog, Sox2, and Pou5f1, and participate in cell differentiation [PMC9505168]. Mmu-mir-134 has also been identified as a potential target of BDNF (Brain-Derived Neurotrophic Factor) by RNAhybrid analysis [PMC9120625]. Luciferase reporter assay confirmed that miR-134 can directly bind to BDNF 3'UTR (3' untranslated region) [PMC9120625]. Mmu-mir-134 is associated with the 'Mitotic Roles of Polo-Like-Kinase' pathway [PMC5220332]. It has also been validated as a degrader of Oct4 and Nanog proteins [PMC3937077]. Mmu-mir-134 is involved in the regulation of insulin secretion and the development of AD (Alzheimer's Disease) [PMC7041741] [PMC8036276] It regulates the development of cortical neurons and is involved in the transformation of neuronal progenitor cells into neuron-like cells [PMC6906698] It has also been shown to be downregulated in AD patients and regulates BACE1 expression, which is associated with disease progression in AD patients. The expression levels of mmu-mir-134 have been validated using real-time quantitative PCR with TaqMan miRNA assays.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGACUGGUUGACCAGAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-134
  2. Canis lupus familiaris (dog) cfa-miR-134
  3. Capra hircus (goat) chi-miR-134
  4. Cavia porcellus cpo-miR-134-5p
  5. Cricetulus griseus cgr-miR-134
  6. Equus caballus eca-miR-134
  7. Homo sapiens hsa-miR-134-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-134-5p
  9. Pan troglodytes ptr-miR-134
  10. Rattus norvegicus rno-miR-134-5p
Publications