Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (domestic cattle) bta-miR-139 secondary structure diagram

Bos taurus (domestic cattle) bta-miR-139 URS000025D232_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-139: Bta-mir-139 is a type of mature microRNA that is assumed to share the same sequence as its human counterpart, hsa-miR-139-5p [PMC5702184]. This microRNA has been studied for its interaction with the 3′-UTR of target genes such as GHR and IGF1R, where specific binding regions have been predicted [PMC5702184]. In experimental setups, cells were co-transfected with bta-mir-139 mimic or inhibitor and a luciferase reporter construct to assess the microRNA's regulatory effects [PMC5702184]. Additionally, bta-mir-139's role in cell proliferation was investigated using MTT assays at various time points post-transfection [PMC5702184]. In the context of bovine cells, bta-mir-139 was found to be more abundant in mammary gland-derived stem cells (MDSCs) than in their progeny (MDSC-P) [PMC5415838], indicating a potential role in stem cell function or differentiation. Furthermore, bta-mir-139 has been included in networks of differentially expressed microRNAs (DEmiRNAs) and their target genes, suggesting its involvement in regulatory pathways within bovine cells [PMC6720277]. The negative regulatory relationship between bta-mir-139 and its target genes ABCC3/PDE5A was validated to understand its functional implications better [PMC6720277].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUACAGUGCACGUGUCUCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications