v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Microcebus murinus (gray mouse lemur) Mmr-Mir-139_5p (mature (guide)) secondary structure diagram

Microcebus murinus (gray mouse lemur) Mmr-Mir-139_5p (mature (guide)) URS000025D232_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUACAGUGCACGUGUCUCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (domestic cattle) bta-miR-139
  2. Callithrix jacchus cja-miR-139
  3. Canis lupus familiaris (dog) Cfa-Mir-139_5p (mature (guide))
  4. Cervus elaphus cel-miR-139
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-139-5p
  6. Echinops telfairi Ete-Mir-139_5p (mature (guide))
  7. Equus caballus (horse) Eca-Mir-139_5p (mature (guide))
  8. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-31040
  9. Homo sapiens hsa-miR-139-5p
  10. Loxodonta africana (African savanna elephant) Laf-Mir-139_5p (mature (guide))
  11. Macaca mulatta Mml-Mir-139_5p (mature (guide))
  12. Mus musculus (house mouse) Mmu-Mir-139_5p (mature (guide))
  13. Oryctolagus cuniculus ocu-miR-139-5p
  14. Pongo abelii (Sumatran orangutan) Pab-Mir-139_5p (mature (co-guide))
  15. Rattus norvegicus Rno-Mir-139_5p (mature (guide))
  16. Tupaia chinensis (Chinese tree shrew) tch-miR-139-5p
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...